Gene Information

Name : THI_1994 (THI_1994)
Accession : YP_003624479.1
Strain : Thiomonas sp. 3As
Genome accession: NC_014145
Putative virulence/resistance : Resistance
Product : putative Bacterial regulatory protein, MerR family
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 1957563 - 1958033 bp
Length : 471 bp
Strand : -
Note : Evidence 3 : Function proposed based on presence of conserved amino acid motif, structural feature or limited homology; Product type pr : putative regulator

DNA sequence : 
ATGCGAATCGGGGAATTAGCGCGGCGCGGCCACTGCGACGTGGAGACGGTGCGTTTTTACGAGCGCGAGGGCTTGCTGGA
TGCGCCCGCCCGCGAGGGCAACGGCTATCGCAACTACACCGGCGGCCATATGGTGCAACTCAACTTCATTCGTCACTGCC
GCTCTCTCGGCATGGGATTGCCGGACGTGCGGGTGTTGCGCGGCTTTCAGGAACATCCTGAATCTGCGTGCGACGACATC
AACCAGTTGATCGACCGGCAGATCGCGCGCATTCATCATCAGGTCGAATCACTGCGCCTGCTGGAGCAGCAGTTGCACGC
GTTGCGCGAGACCTGCCAGGCCAACCGGACGGCGAGCGACTGCGGCATCATGCAGAACCTGCAACAGGCCGCGGCCGGCG
GGCCATGCGAATGCCATGCGGAGCCGGTCGATCGGCCCGGAGCGGATCCTCGAGGTGGCGGGTCGGCGTGA

Protein sequence : 
MRIGELARRGHCDVETVRFYEREGLLDAPAREGNGYRNYTGGHMVQLNFIRHCRSLGMGLPDVRVLRGFQEHPESACDDI
NQLIDRQIARIHHQVESLRLLEQQLHALRETCQANRTASDCGIMQNLQQAAAGGPCECHAEPVDRPGADPRGGGSA

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
ORF C98 AAN62191.1 putative transcriptional regulator Not tested PAGI-2(C) Protein 3e-30 44
cadR ACS32041.1 MerR family transcriptional regulator Not tested AbaR5 Protein 4e-30 41
cadR ADZ05769.1 MerR family transcriptional regulator Not tested AbaR11 Protein 3e-30 41
ACICU_00234 YP_001844893.1 transcriptional regulator Not tested AbaR20 Protein 5e-30 41
cadR ACN81029.1 MerR family transcriptional regulator Not tested AbaR5 Protein 5e-30 41
pbrR CAJ77094.1 Transcriptional regulator Not tested AbaR1 Protein 3e-30 41
cadR AGK36653.1 MerR family transcriptional regulator Not tested AbaR26 Protein 3e-30 41
pbrR CAJ77021.1 transcription regulator Not tested AbaR1 Protein 3e-30 41

• Homologs from CARD and BacMet (resistance genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
THI_1994 YP_003624479.1 putative Bacterial regulatory protein, MerR family BAC0301 Protein 8e-25 45
THI_1994 YP_003624479.1 putative Bacterial regulatory protein, MerR family BAC0058 Protein 3e-30 41