Gene Information

Name : yeeV1 (G2583_2524)
Accession : -
Strain : Escherichia coli CB9615
Genome accession: NC_013941
Putative virulence/resistance : Virulence
Product : -
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2529739 - 2530112 bp
Length : 374 bp
Strand : +
Note : hypothetical protein

DNA sequence :
ATGAAAACATTACCTGTATTACCCGGGCAGGCGGCCAGTTCTCGCCCGTCTCCTGTTGAAATCTGGCAGATACTGCTGTC
CCGACTGCTGGACCAGCACTATGGCCTCACACTGAATGACACACCTTTTGCCGATGAACGTGTGATTGAGCAGCATATTG
AGGCAGGCATTTCACTGTGTGATGCGGTGAACTTTCTCGTGGAAAAATACGCGCTGGTGCTACCGACCAGCCGGGATTCA
GCGCCTGTACCCGCTCTCAGTTAATAAACAGCATCGATATCCTCCTGGCTCGCAGGGCGACCGGCCTGATGACCCGCGAC
AATTACAGAACGGTAAATAACATTACCCTGGGTAAGTATCCGGAGGCGAAATGA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
yeeV YP_853122.1 toxin of the YeeV-YeeU toxin-antitoxin system Virulence PAI IV APEC-O1 DNA e-146 99.6
unnamed AAL08478.1 unknown Not tested SRL DNA e-163 93.9
yeeV CAE85204.1 YeeV protein Not tested PAI V 536 DNA 1e-82 93.7
unnamed CAD42101.1 hypothetical protein Not tested PAI II 536 DNA e-152 92.9
z5091 CAD33789.1 Z5091 protein Not tested PAI I 536 DNA e-172 90.6
unnamed AAC31486.1 L0007 Not tested LEE DNA e-170 89.8
Z5091 NP_290242.1 hypothetical protein Not tested LEE DNA e-170 89.8
ECs4539 NP_312566.1 hypothetical protein Not tested LEE DNA e-170 89.8
unnamed ACU09433.1 conserved hypothetical protein Not tested LEE DNA e-170 89.8
yeeV YP_854325.1 hypothetical protein Not tested PAI I APEC-O1 DNA e-144 89.5
unnamed AAK00482.1 unknown Not tested SHI-1 DNA e-134 89.2
yeeV NP_708773.1 hypothetical protein Not tested SHI-1 DNA e-134 89.2
yeeV NP_838487.1 hypothetical protein Not tested SHI-1 DNA e-134 89.2
unnamed CAI43848.1 hypothetical protein Not tested LEE DNA e-159 87.9
aec76 AAW51759.1 Aec76 Not tested AGI-3 DNA e-159 87.9
unnamed CAD66207.1 hypothetical protein Not tested PAI III 536 DNA e-159 87.6
unnamed AAL57575.1 unknown Not tested LEE DNA e-160 87.6
yeeV ADD91699.1 YeeV Not tested PAI-I AL862 DNA e-160 87.4
c5149 NP_756997.1 hypothetical protein Not tested PAI II CFT073 DNA e-158 86.8
unnamed AAL67389.1 L0007-like protein Not tested PAI II CFT073 DNA e-158 86.8
unnamed AAL67342.1 intergenic-region protein Not tested PAI II CFT073 DNA e-136 85.5
ECO103_3592 YP_003223449.1 hypothetical protein Not tested LEE DNA 1e-85 84.8