Name : xsaX (XALc_1500) Accession : YP_003375995.1 Strain : Xanthomonas albilineans GPE PC73 Genome accession: NC_013722 Putative virulence/resistance : Virulence Product : xanthomonas secretion apparatus protein Function : - COG functional category : U : Intracellular trafficking, secretion and vesicular transport COG ID : COG4794 EC number : - Position : 1724731 - 1724997 bp Length : 267 bp Strand : + Note : - DNA sequence : ATGGAAAAAATCATCTACGCGGTAAATAAAGCACTTGTTCTCGTACTCCTGCTTTCCGCGCCGGCAATTATTACTGCCAC CATCGTCGGCATTGCAATGGGATTGTTTCAAACCGTCACCCAACTGCAGGAGCAGACCCTGCCATTCGGTGTGAAATTGA TTGCCGTGTTGGCTTGTCTGCTTCTACTTGAGCCATGGATGGCGATGATCGTGATGAGATTCGCGCGAGAAGTCTTTCGA ATGGCGTTCCTGAGCGGAGCTGGCTGA Protein sequence : MEKIIYAVNKALVLVLLLSAPAIITATIVGIAMGLFQTVTQLQEQTLPFGVKLIAVLACLLLLEPWMAMIVMRFAREVFR MAFLSGAG |
Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
ysaS | AAS66847.1 | YsaS | Not tested | SSR-1 | Protein | 1e-08 | 60 |
spaQ | AAS66866.1 | SpaQ | Not tested | SSR-2 | Protein | 2e-11 | 56 |
spaQ | YP_217808.1 | surface presentation of antigens; secretory proteins | Virulence | SPI-1 | Protein | 1e-09 | 56 |
spaQ | NP_457283.1 | secretory protein (associated with virulence) | Virulence | SPI-1 | Protein | 1e-09 | 56 |
spaQ | NP_806492.1 | virulence-associated secretory protein | Virulence | SPI-1 | Protein | 1e-09 | 56 |
spaQ | NP_461810.1 | needle complex export protein | Virulence | SPI-1 | Protein | 1e-09 | 56 |
epaQ | AAZ31292.1 | EpaQ | Virulence | ETT2 | Protein | 3e-09 | 52 |
ECs3724 | NP_311751.1 | EpaQ | Not tested | LIM | Protein | 3e-09 | 52 |
hrcS | ABA47280.1 | HrcS | Virulence | S-PAI | Protein | 1e-06 | 50 |
escS | YP_003223489.1 | T3SS structure protein EscS | Virulence | LEE | Protein | 6e-07 | 48 |
escS | YP_003232139.1 | T3SS structure protein EscS | Virulence | LEE | Protein | 6e-07 | 48 |
escS | AAK26701.1 | EscS | Virulence | LEE | Protein | 4e-07 | 48 |
escS | AAL57528.1 | EscS | Virulence | LEE | Protein | 4e-07 | 48 |
escS | CAC81848.1 | EscS protein | Virulence | LEE II | Protein | 4e-07 | 48 |
hrcS | AAT96263.1 | HrcS | Virulence | S-PAI | Protein | 2e-06 | 47 |
hrcS | AAT96304.1 | HrcS | Virulence | S-PAI | Protein | 2e-06 | 47 |
hrcS | AAT96344.1 | HrcS | Virulence | S-PAI | Protein | 2e-06 | 47 |
ECs4582 | NP_312609.1 | EscS | Virulence | LEE | Protein | 7e-07 | 47 |
escS | AAC31527.1 | L0048 | Virulence | LEE | Protein | 5e-07 | 47 |
escS | ACU09472.1 | hypothetical protein | Not tested | LEE | Protein | 5e-07 | 47 |
unnamed | AAL06355.1 | EscS | Virulence | LEE | Protein | 3e-07 | 47 |
escS | YP_003236102.1 | T3SS structure protein EscS | Virulence | LEE | Protein | 7e-07 | 47 |
escS | CAI43888.1 | EscS protein | Virulence | LEE | Protein | 7e-07 | 47 |
escS | NP_290282.1 | hypothetical protein | Virulence | LEE | Protein | 7e-07 | 47 |
escS | AAC38370.1 | EscS | Virulence | LEE | Protein | 5e-07 | 47 |
hrcS | AAB06006.1 | HrcS | Virulence | Hrp PAI | Protein | 2e-07 | 45 |
escS | AFO66341.1 | putative LEE-encoded type III secretion system factor | Virulence | SESS LEE | Protein | 1e-06 | 42 |
escS | AFO66401.1 | putative LEE-encoded type III secretion system factor | Virulence | SESS LEE | Protein | 1e-06 | 42 |
Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
xsaX | YP_003375995.1 | xanthomonas secretion apparatus protein | VFG1772 | Protein | 1e-11 | 56 |
xsaX | YP_003375995.1 | xanthomonas secretion apparatus protein | VFG0550 | Protein | 3e-10 | 56 |
xsaX | YP_003375995.1 | xanthomonas secretion apparatus protein | VFG1013 | Protein | 1e-08 | 52 |
xsaX | YP_003375995.1 | xanthomonas secretion apparatus protein | VFG2454 | Protein | 1e-07 | 51 |
xsaX | YP_003375995.1 | xanthomonas secretion apparatus protein | VFG0716 | Protein | 2e-07 | 47 |
xsaX | YP_003375995.1 | xanthomonas secretion apparatus protein | VFG0826 | Protein | 2e-07 | 47 |