Gene Information

Name : xsaX (XALc_1500)
Accession : YP_003375995.1
Strain : Xanthomonas albilineans GPE PC73
Genome accession: NC_013722
Putative virulence/resistance : Virulence
Product : xanthomonas secretion apparatus protein
Function : -
COG functional category : U : Intracellular trafficking, secretion and vesicular transport
COG ID : COG4794
EC number : -
Position : 1724731 - 1724997 bp
Length : 267 bp
Strand : +
Note : -

DNA sequence :
ATGGAAAAAATCATCTACGCGGTAAATAAAGCACTTGTTCTCGTACTCCTGCTTTCCGCGCCGGCAATTATTACTGCCAC
CATCGTCGGCATTGCAATGGGATTGTTTCAAACCGTCACCCAACTGCAGGAGCAGACCCTGCCATTCGGTGTGAAATTGA
TTGCCGTGTTGGCTTGTCTGCTTCTACTTGAGCCATGGATGGCGATGATCGTGATGAGATTCGCGCGAGAAGTCTTTCGA
ATGGCGTTCCTGAGCGGAGCTGGCTGA

Protein sequence :
MEKIIYAVNKALVLVLLLSAPAIITATIVGIAMGLFQTVTQLQEQTLPFGVKLIAVLACLLLLEPWMAMIVMRFAREVFR
MAFLSGAG

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
ysaS AAS66847.1 YsaS Not tested SSR-1 Protein 1e-08 60
spaQ AAS66866.1 SpaQ Not tested SSR-2 Protein 2e-11 56
spaQ YP_217808.1 surface presentation of antigens; secretory proteins Virulence SPI-1 Protein 1e-09 56
spaQ NP_457283.1 secretory protein (associated with virulence) Virulence SPI-1 Protein 1e-09 56
spaQ NP_806492.1 virulence-associated secretory protein Virulence SPI-1 Protein 1e-09 56
spaQ NP_461810.1 needle complex export protein Virulence SPI-1 Protein 1e-09 56
ECs3724 NP_311751.1 EpaQ Not tested LIM Protein 3e-09 52
epaQ AAZ31292.1 EpaQ Virulence ETT2 Protein 3e-09 52
hrcS ABA47280.1 HrcS Virulence S-PAI Protein 1e-06 50
escS AAL57528.1 EscS Virulence LEE Protein 4e-07 48
escS CAC81848.1 EscS protein Virulence LEE II Protein 4e-07 48
escS YP_003223489.1 T3SS structure protein EscS Virulence LEE Protein 6e-07 48
escS YP_003232139.1 T3SS structure protein EscS Virulence LEE Protein 6e-07 48
escS AAK26701.1 EscS Virulence LEE Protein 4e-07 48
hrcS AAT96263.1 HrcS Virulence S-PAI Protein 2e-06 47
hrcS AAT96304.1 HrcS Virulence S-PAI Protein 2e-06 47
hrcS AAT96344.1 HrcS Virulence S-PAI Protein 2e-06 47
unnamed AAL06355.1 EscS Virulence LEE Protein 3e-07 47
escS YP_003236102.1 T3SS structure protein EscS Virulence LEE Protein 7e-07 47
escS CAI43888.1 EscS protein Virulence LEE Protein 7e-07 47
escS NP_290282.1 hypothetical protein Virulence LEE Protein 7e-07 47
escS AAC38370.1 EscS Virulence LEE Protein 5e-07 47
ECs4582 NP_312609.1 EscS Virulence LEE Protein 7e-07 47
escS AAC31527.1 L0048 Virulence LEE Protein 5e-07 47
escS ACU09472.1 hypothetical protein Not tested LEE Protein 5e-07 47
hrcS AAB06006.1 HrcS Virulence Hrp PAI Protein 2e-07 45
escS AFO66341.1 putative LEE-encoded type III secretion system factor Virulence SESS LEE Protein 1e-06 42
escS AFO66401.1 putative LEE-encoded type III secretion system factor Virulence SESS LEE Protein 1e-06 42

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
xsaX YP_003375995.1 xanthomonas secretion apparatus protein VFG1772 Protein 1e-11 56
xsaX YP_003375995.1 xanthomonas secretion apparatus protein VFG0550 Protein 3e-10 56
xsaX YP_003375995.1 xanthomonas secretion apparatus protein VFG1013 Protein 1e-08 52
xsaX YP_003375995.1 xanthomonas secretion apparatus protein VFG2454 Protein 1e-07 51
xsaX YP_003375995.1 xanthomonas secretion apparatus protein VFG0826 Protein 2e-07 47
xsaX YP_003375995.1 xanthomonas secretion apparatus protein VFG0716 Protein 2e-07 47