Name : ECBD_0049 (ECBD_0049) Accession : YP_003034314.1 Strain : Escherichia coli Escherichia coli BL21-Gold(DE3)pLysS AG Genome accession: NC_012947 Putative virulence/resistance : Virulence Product : hypothetical protein Function : - COG functional category : - COG ID : - EC number : - Position : 49272 - 49469 bp Length : 198 bp Strand : - Note : PFAM: protein of unknown function DUF957; KEGG: sfl:SF3001 hypothetical protein DNA sequence : ATGAAATCATTAACCACGGAAACAGCACTGGATATTCTGATTGCGTGGCTGCAGGACAATATCGACTGCGAATCGGGAAT TATCTTTGACAACGATGAGGATAAAACGGATTCGGCAGCACTGCTGCCCTGCATTGAACAGGCGAGGGAGGATATCCATA CCCTGCGCCAACTGCAGCTTCTGCAACAGAACCGGTGA Protein sequence : MKSLTTETALDILIAWLQDNIDCESGIIFDNDEDKTDSAALLPCIEQAREDIHTLRQLQLLQQNR |
Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
ECO103_3594 | YP_003223451.1 | hypothetical protein | Not tested | LEE | Protein | 1e-17 | 99 |
ECO111_3780 | YP_003236115.1 | hypothetical protein | Not tested | LEE | Protein | 1e-17 | 97 |
unnamed | AAK00484.1 | unknown | Not tested | SHI-1 | Protein | 4e-17 | 97 |
SF3001 | NP_708775.1 | hypothetical protein | Not tested | SHI-1 | Protein | 5e-17 | 97 |
unnamed | AAL08480.1 | unknown | Not tested | SRL | Protein | 2e-17 | 95 |
Z1225 | NP_286759.1 | hypothetical protein | Not tested | TAI | Protein | 3e-17 | 95 |
c5147 | NP_756995.1 | hypothetical protein | Not tested | PAI II CFT073 | Protein | 4e-17 | 93 |
unnamed | AAL67387.1 | L0009-like protein | Not tested | PAI II CFT073 | Protein | 3e-17 | 93 |
unnamed | AAC31488.1 | L0009 | Not tested | LEE | Protein | 5e-16 | 88 |
unnamed | ACU09435.1 | conserved hypothetical protein | Not tested | LEE | Protein | 5e-16 | 88 |
Z5093 | NP_290244.1 | hypothetical protein | Not tested | LEE | Protein | 7e-16 | 88 |
ECs4541 | NP_312568.1 | hypothetical protein | Not tested | LEE | Protein | 7e-16 | 88 |
Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
ECBD_0049 | YP_003034314.1 | hypothetical protein | VFG0665 | Protein | 2e-17 | 97 |
ECBD_0049 | YP_003034314.1 | hypothetical protein | VFG1071 | Protein | 8e-18 | 95 |
ECBD_0049 | YP_003034314.1 | hypothetical protein | VFG0788 | Protein | 2e-16 | 88 |