Gene Information

Name : PLES_12951 (PLES_12951)
Accession : YP_002438898.1
Strain : Pseudomonas aeruginosa LESB58
Genome accession: NC_011770
Putative virulence/resistance : Resistance
Product : putative transcriptional regulator
Function : -
COG functional category : K : Transcription
COG ID : COG0789
EC number : -
Position : 1406096 - 1406566 bp
Length : 471 bp
Strand : +
Note : -

DNA sequence : 
ATGAAGATCGGTGAGCTGGCGAAGAGAACCGGTTGCCCGGTGGAGACCATCCGCTACTACGAGCGCGAAGGCCTGTTGCC
CGAGCCCGCGCGTAGCGAAGGCAACTATCGGCAATACACCCTGGCGCATGTCGAGCGCCTGTCGTTCATCCGTCACTGCC
GCTCGCTGGACATGACCCAGGAGGAAATCCGTACCCTGCTGGCGTTGCGCGACCGTCCCGAGGCGGATTGCGGCACCGCC
AACCGGTTGATCGACGAGCACCTGCATCACGTCGAGGTGCGCATCGCCGAACTCCAGGCATTGCGCGAGCAACTGCGGGA
TCTCGGCTCACGCTGTACGGTCGCCGGCAACAGCCAGGCCTGCGGCATCCTCCGCGAACTGGAGCAGCCCGCGCCGCTGT
CGCCAATCGCCGAGGAATGCGCCGAGGCCGGGCACATGCACGTCCCCGGCGTGCACCGCCGGCATGGCTGA

Protein sequence : 
MKIGELAKRTGCPVETIRYYEREGLLPEPARSEGNYRQYTLAHVERLSFIRHCRSLDMTQEEIRTLLALRDRPEADCGTA
NRLIDEHLHHVEVRIAELQALREQLRDLGSRCTVAGNSQACGILRELEQPAPLSPIAEECAEAGHMHVPGVHRRHG

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
ORF C98 AAN62191.1 putative transcriptional regulator Not tested PAGI-2(C) Protein 8e-34 56
cadR ADZ05769.1 MerR family transcriptional regulator Not tested AbaR11 Protein 5e-28 47
cadR ACS32041.1 MerR family transcriptional regulator Not tested AbaR5 Protein 7e-28 47
ACICU_00234 YP_001844893.1 transcriptional regulator Not tested AbaR20 Protein 6e-28 47
cadR ACN81029.1 MerR family transcriptional regulator Not tested AbaR5 Protein 5e-28 47
pbrR CAJ77021.1 transcription regulator Not tested AbaR1 Protein 5e-28 47
pbrR CAJ77094.1 Transcriptional regulator Not tested AbaR1 Protein 4e-28 47
cadR AGK36653.1 MerR family transcriptional regulator Not tested AbaR26 Protein 4e-28 47

• Homologs from CARD and BacMet (resistance genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
PLES_12951 YP_002438898.1 putative transcriptional regulator BAC0058 Protein 2e-40 61
PLES_12951 YP_002438898.1 putative transcriptional regulator BAC0301 Protein 3e-32 58
PLES_12951 YP_002438898.1 putative transcriptional regulator BAC0462 Protein 3e-23 43