Gene Information

Name : ECS88_3317 (ECS88_3317)
Accession : YP_002392926.1
Strain : Escherichia coli S88
Genome accession: NC_011742
Putative virulence/resistance : Virulence
Product : hypothetical protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 3272731 - 3272973 bp
Length : 243 bp
Strand : +
Note : Evidence 4 : Homologs of previously reported genes of unknown function

DNA sequence :
ATGCCTGCCGGGTTTACCCACTTTCAACTGGTAACCAGGAACAACATGAAATCATTAACCACGGAAACAGCACTGGATAT
TCTGATTGCGTGGCTGCAGGACAATATCGACTGTGAATCCGGGATTATCTTCGACAACGATGAGGATAAGACGGATTCAG
CAGCACTGTTGCCCTGCATCGAACAGGCCCGGGAGGATGTCCGTGCTGTTCGTCATCTGCAGCTTCTGCACCAGAACCGG
TGA

Protein sequence :
MPAGFTHFQLVTRNNMKSLTTETALDILIAWLQDNIDCESGIIFDNDEDKTDSAALLPCIEQAREDVRAVRHLQLLHQNR

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
ECO111_3780 YP_003236115.1 hypothetical protein Not tested LEE Protein 1e-23 97
Z1225 NP_286759.1 hypothetical protein Not tested TAI Protein 3e-23 96
unnamed AAL08480.1 unknown Not tested SRL Protein 2e-23 96
aec78 AAW51761.1 Aec78 Not tested AGI-3 Protein 1e-25 96
Z1663 NP_287165.1 hypothetical protein Not tested TAI Protein 1e-30 95
unnamed CAE85206.1 hypothetical protein Not tested PAI V 536 Protein 2e-30 95
unnamed CAI43905.1 hypothetical protein Not tested LEE Protein 2e-25 95
unnamed AAL67387.1 L0009-like protein Not tested PAI II CFT073 Protein 4e-23 94
c5147 NP_756995.1 hypothetical protein Not tested PAI II CFT073 Protein 6e-23 94
unnamed CAI43850.1 hypothetical protein Not tested LEE Protein 3e-30 93
unnamed AAL57573.1 unknown Not tested LEE Protein 1e-24 93
unnamed ADD91697.1 hypothetical conserved protein Not tested PAI-I AL862 Protein 8e-30 92
ECO103_3594 YP_003223451.1 hypothetical protein Not tested LEE Protein 1e-21 91
unnamed CAD42103.1 hypothetical protein Not tested PAI II 536 Protein 5e-28 90
unnamed CAD66209.1 hypothetical protein Not tested PAI III 536 Protein 2e-29 90
z1225 CAD33791.1 Z1225 protein Not tested PAI I 536 Protein 2e-29 90
unnamed AAK00484.1 unknown Not tested SHI-1 Protein 1e-21 90
SF3001 NP_708775.1 hypothetical protein Not tested SHI-1 Protein 2e-21 90

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
ECS88_3317 YP_002392926.1 hypothetical protein VFG1071 Protein 9e-24 96
ECS88_3317 YP_002392926.1 hypothetical protein VFG1684 Protein 9e-30 90
ECS88_3317 YP_002392926.1 hypothetical protein VFG0665 Protein 5e-22 90
ECS88_3317 YP_002392926.1 hypothetical protein VFG1622 Protein 2e-28 90
ECS88_3317 YP_002392926.1 hypothetical protein VFG1532 Protein 7e-30 90