|
Name : ECS88_3317 (ECS88_3317) Accession : YP_002392926.1 Strain : Escherichia coli S88 Genome accession: NC_011742 Putative virulence/resistance : Virulence Product : hypothetical protein Function : - COG functional category : - COG ID : - EC number : - Position : 3272731 - 3272973 bp Length : 243 bp Strand : + Note : Evidence 4 : Homologs of previously reported genes of unknown function DNA sequence : ATGCCTGCCGGGTTTACCCACTTTCAACTGGTAACCAGGAACAACATGAAATCATTAACCACGGAAACAGCACTGGATAT TCTGATTGCGTGGCTGCAGGACAATATCGACTGTGAATCCGGGATTATCTTCGACAACGATGAGGATAAGACGGATTCAG CAGCACTGTTGCCCTGCATCGAACAGGCCCGGGAGGATGTCCGTGCTGTTCGTCATCTGCAGCTTCTGCACCAGAACCGG TGA Protein sequence : MPAGFTHFQLVTRNNMKSLTTETALDILIAWLQDNIDCESGIIFDNDEDKTDSAALLPCIEQAREDVRAVRHLQLLHQNR |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| ECO111_3780 | YP_003236115.1 | hypothetical protein | Not tested | LEE | Protein | 1e-23 | 97 |
| unnamed | AAL08480.1 | unknown | Not tested | SRL | Protein | 2e-23 | 96 |
| Z1225 | NP_286759.1 | hypothetical protein | Not tested | TAI | Protein | 3e-23 | 96 |
| aec78 | AAW51761.1 | Aec78 | Not tested | AGI-3 | Protein | 1e-25 | 96 |
| unnamed | CAE85206.1 | hypothetical protein | Not tested | PAI V 536 | Protein | 2e-30 | 95 |
| Z1663 | NP_287165.1 | hypothetical protein | Not tested | TAI | Protein | 1e-30 | 95 |
| unnamed | CAI43905.1 | hypothetical protein | Not tested | LEE | Protein | 2e-25 | 95 |
| unnamed | AAL67387.1 | L0009-like protein | Not tested | PAI II CFT073 | Protein | 4e-23 | 94 |
| c5147 | NP_756995.1 | hypothetical protein | Not tested | PAI II CFT073 | Protein | 6e-23 | 94 |
| unnamed | CAI43850.1 | hypothetical protein | Not tested | LEE | Protein | 3e-30 | 93 |
| unnamed | AAL57573.1 | unknown | Not tested | LEE | Protein | 1e-24 | 93 |
| unnamed | ADD91697.1 | hypothetical conserved protein | Not tested | PAI-I AL862 | Protein | 8e-30 | 92 |
| ECO103_3594 | YP_003223451.1 | hypothetical protein | Not tested | LEE | Protein | 1e-21 | 91 |
| SF3001 | NP_708775.1 | hypothetical protein | Not tested | SHI-1 | Protein | 2e-21 | 90 |
| unnamed | CAD42103.1 | hypothetical protein | Not tested | PAI II 536 | Protein | 5e-28 | 90 |
| unnamed | CAD66209.1 | hypothetical protein | Not tested | PAI III 536 | Protein | 2e-29 | 90 |
| z1225 | CAD33791.1 | Z1225 protein | Not tested | PAI I 536 | Protein | 2e-29 | 90 |
| unnamed | AAK00484.1 | unknown | Not tested | SHI-1 | Protein | 1e-21 | 90 |
| Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
| ECS88_3317 | YP_002392926.1 | hypothetical protein | VFG1071 | Protein | 9e-24 | 96 |
| ECS88_3317 | YP_002392926.1 | hypothetical protein | VFG1622 | Protein | 2e-28 | 90 |
| ECS88_3317 | YP_002392926.1 | hypothetical protein | VFG1532 | Protein | 7e-30 | 90 |
| ECS88_3317 | YP_002392926.1 | hypothetical protein | VFG1684 | Protein | 9e-30 | 90 |
| ECS88_3317 | YP_002392926.1 | hypothetical protein | VFG0665 | Protein | 5e-22 | 90 |
