Gene Information

Name : ECH74115_5038 (ECH74115_5038)
Accession : -
Strain : Escherichia coli EC4115
Genome accession: NC_011353
Putative virulence/resistance : Unknown
Product : -
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 4687784 - 4687981 bp
Length : 198 bp
Strand : +
Note : conserved hypothetical protein; this gene contains a premature stop which may be the result of sequencing error; identified by match to protein family HMM PF06117

DNA sequence :
ATGACATCATTAACCCCGGAAGCAGCACTGGATATTCTGATTGCGTGGCTGCAGGACAATATCGACAGCGAATCCGGAAT
TATCTTCGACAACGATGAGGATAAAACGGATTCGGCAGCATTGTTGCCCTGTATCGAACAGGTCAGGGAAGATGTCCGTA
CCCTGCGCCAACTGCAGCTTCTGCAACAGAACCGGTGA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
Z5093 NP_290244.1 hypothetical protein Not tested LEE DNA e-108 100
ECs4541 NP_312568.1 hypothetical protein Not tested LEE DNA e-108 100
unnamed ACU09435.1 conserved hypothetical protein Not tested LEE DNA e-108 100
unnamed AAC31488.1 L0009 Not tested LEE DNA e-108 100
SF3001 NP_708775.1 hypothetical protein Not tested SHI-1 DNA 1e-81 93
unnamed AAK00484.1 unknown Not tested SHI-1 DNA 1e-81 93
aec78 AAW51761.1 Aec78 Not tested AGI-3 DNA 2e-93 92.4
z1225 CAD33791.1 Z1225 protein Not tested PAI I 536 DNA 5e-94 92.4
unnamed AAL08480.1 unknown Not tested SRL DNA 9e-92 91.9
Z1225 NP_286759.1 hypothetical protein Not tested TAI DNA 9e-92 91.9
unnamed ADD91697.1 hypothetical conserved protein Not tested PAI-I AL862 DNA 3e-92 91.9
unnamed CAI43850.1 hypothetical protein Not tested LEE DNA 1e-91 91.9
Z1663 NP_287165.1 hypothetical protein Not tested TAI DNA 9e-92 91.9
unnamed CAD66209.1 hypothetical protein Not tested PAI III 536 DNA 6e-92 91.4
unnamed CAI43905.1 hypothetical protein Not tested LEE DNA 2e-91 91.4
unnamed CAD42103.1 hypothetical protein Not tested PAI II 536 DNA 2e-90 91.4
unnamed AAL67387.1 L0009-like protein Not tested PAI II CFT073 DNA 1e-89 90.9
c5147 NP_756995.1 hypothetical protein Not tested PAI II CFT073 DNA 1e-89 90.9
unnamed AAL57573.1 unknown Not tested LEE DNA 1e-90 90.9
ECO103_3594 YP_003223451.1 hypothetical protein Not tested LEE DNA 8e-90 90.4
ECO111_3780 YP_003236115.1 hypothetical protein Not tested LEE DNA 6e-87 89.9
unnamed CAE85206.1 hypothetical protein Not tested PAI V 536 DNA 4e-86 89.4