Gene Information

Name : SeD_A3213 (SeD_A3213)
Accession : -
Strain : Salmonella enterica CT_02021853
Genome accession: NC_011205
Putative virulence/resistance : Unknown
Product : -
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 3090967 - 3091107 bp
Length : 141 bp
Strand : -
Note : probable transposase for transposon; this gene contains a frame shift which may be the result of sequencing error

DNA sequence :
ATGTTCCGTATCAAAACCTTGCTGGGCGGCCATCTGAGCCAGCGGAACTATGGTGCGCAGGTGGGTGAAGCGATGGCGAT
GGTCAAAGCGCTGAACCGGATGACGTTGTTGGCAATGCCGACCAGCGTCAGGCTCGTATAA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
STM2906 - - Not tested SPI-1 DNA 5e-72 97.9
SC2835 YP_217822.1 hypothetical protein Not tested SPI-1 DNA 3e-71 97.2