Gene Information

Name : SeAg_B3026 (SeAg_B3026)
Accession : -
Strain : Salmonella enterica SL483
Genome accession: NC_011149
Putative virulence/resistance : Unknown
Product : -
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2956649 - 2956789 bp
Length : 141 bp
Strand : -
Note : probable transposase for transposon; this gene contains a frame shift which may be the result of sequencing error

DNA sequence :
ATGTTCCGTATCAAAACCTTGCTGGGCGGCCATCTGAGCCTGCGGAACTATGACGCGCAGGTGGGTGAAGTGATGGCGAT
GGTCAAAGCGCTGAACCGGATGACGTTGTTGGCAATGCCGACCAGCGTCAGGCTCGTATAA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
STM2906 - - Not tested SPI-1 DNA 5e-74 99.3
SC2835 YP_217822.1 hypothetical protein Not tested SPI-1 DNA 3e-73 98.6