Name : SeAg_B3026 (SeAg_B3026) Accession : - Strain : Salmonella enterica SL483 Genome accession: NC_011149 Putative virulence/resistance : Unknown Product : - Function : - COG functional category : - COG ID : - EC number : - Position : 2956649 - 2956789 bp Length : 141 bp Strand : - Note : probable transposase for transposon; this gene contains a frame shift which may be the result of sequencing error DNA sequence : ATGTTCCGTATCAAAACCTTGCTGGGCGGCCATCTGAGCCTGCGGAACTATGACGCGCAGGTGGGTGAAGTGATGGCGAT GGTCAAAGCGCTGAACCGGATGACGTTGTTGGCAATGCCGACCAGCGTCAGGCTCGTATAA Protein sequence : - |
Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
STM2906 | - | - | Not tested | SPI-1 | DNA | 5e-74 | 99.3 |
SC2835 | YP_217822.1 | hypothetical protein | Not tested | SPI-1 | DNA | 3e-73 | 98.6 |