|
Name : SeHA_C4674 (SeHA_C4674) Accession : YP_002048311.1 Strain : Salmonella enterica SL476 Genome accession: NC_011083 Putative virulence/resistance : Virulence Product : hypothetical protein Function : - COG functional category : - COG ID : - EC number : - Position : 4564420 - 4564617 bp Length : 198 bp Strand : - Note : identified by match to protein family HMM PF06117 DNA sequence : ATGAAATCATTAACCACAGAAACAGCGCTGGATATTCTGATTGCGTGGCTGCAGGACAATATTGACTGCGAATCGGAAAT TATCTTTGACAACGATGAGGATAAAACGGATTCGACAGCACTGCTGCCCTGCATTGAACAGGCCAGGGAAGATATCCGTA CCCTGCGCCAACTGCAGTTTCTGCAACAGAACCGGTGA Protein sequence : MKSLTTETALDILIAWLQDNIDCESEIIFDNDEDKTDSTALLPCIEQAREDIRTLRQLQFLQQNR |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| SF3001 | NP_708775.1 | hypothetical protein | Not tested | SHI-1 | Protein | 5e-22 | 96 |
| unnamed | AAK00484.1 | unknown | Not tested | SHI-1 | Protein | 4e-22 | 96 |
| z1225 | CAD33791.1 | Z1225 protein | Not tested | PAI I 536 | Protein | 1e-22 | 96 |
| unnamed | CAD66209.1 | hypothetical protein | Not tested | PAI III 536 | Protein | 4e-22 | 94 |
| ECO103_3594 | YP_003223451.1 | hypothetical protein | Not tested | LEE | Protein | 6e-21 | 93 |
| ECO111_3780 | YP_003236115.1 | hypothetical protein | Not tested | LEE | Protein | 7e-22 | 91 |
| unnamed | ADD91697.1 | hypothetical conserved protein | Not tested | PAI-I AL862 | Protein | 3e-21 | 91 |
| unnamed | CAI43850.1 | hypothetical protein | Not tested | LEE | Protein | 2e-21 | 91 |
| Z1225 | NP_286759.1 | hypothetical protein | Not tested | TAI | Protein | 1e-21 | 90 |
| unnamed | AAL08480.1 | unknown | Not tested | SRL | Protein | 9e-22 | 90 |
| Z1663 | NP_287165.1 | hypothetical protein | Not tested | TAI | Protein | 1e-21 | 90 |
| unnamed | CAE85206.1 | hypothetical protein | Not tested | PAI V 536 | Protein | 1e-21 | 90 |
| c5147 | NP_756995.1 | hypothetical protein | Not tested | PAI II CFT073 | Protein | 3e-21 | 88 |
| unnamed | AAL67387.1 | L0009-like protein | Not tested | PAI II CFT073 | Protein | 2e-21 | 88 |
| unnamed | CAD42103.1 | hypothetical protein | Not tested | PAI II 536 | Protein | 3e-21 | 88 |
| unnamed | AAC31488.1 | L0009 | Not tested | LEE | Protein | 1e-15 | 86 |
| Z5093 | NP_290244.1 | hypothetical protein | Not tested | LEE | Protein | 2e-15 | 86 |
| unnamed | ACU09435.1 | conserved hypothetical protein | Not tested | LEE | Protein | 1e-15 | 86 |
| ECs4541 | NP_312568.1 | hypothetical protein | Not tested | LEE | Protein | 2e-15 | 86 |
| Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
| SeHA_C4674 | YP_002048311.1 | hypothetical protein | VFG0665 | Protein | 2e-22 | 96 |
| SeHA_C4674 | YP_002048311.1 | hypothetical protein | VFG1532 | Protein | 5e-23 | 96 |
| SeHA_C4674 | YP_002048311.1 | hypothetical protein | VFG1684 | Protein | 2e-22 | 94 |
| SeHA_C4674 | YP_002048311.1 | hypothetical protein | VFG1071 | Protein | 4e-22 | 90 |
| SeHA_C4674 | YP_002048311.1 | hypothetical protein | VFG1622 | Protein | 1e-21 | 88 |
| SeHA_C4674 | YP_002048311.1 | hypothetical protein | VFG0788 | Protein | 5e-16 | 86 |
