Gene Information

Name : SeHA_C4674 (SeHA_C4674)
Accession : YP_002048311.1
Strain : Salmonella enterica SL476
Genome accession: NC_011083
Putative virulence/resistance : Virulence
Product : hypothetical protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 4564420 - 4564617 bp
Length : 198 bp
Strand : -
Note : identified by match to protein family HMM PF06117

DNA sequence :
ATGAAATCATTAACCACAGAAACAGCGCTGGATATTCTGATTGCGTGGCTGCAGGACAATATTGACTGCGAATCGGAAAT
TATCTTTGACAACGATGAGGATAAAACGGATTCGACAGCACTGCTGCCCTGCATTGAACAGGCCAGGGAAGATATCCGTA
CCCTGCGCCAACTGCAGTTTCTGCAACAGAACCGGTGA

Protein sequence :
MKSLTTETALDILIAWLQDNIDCESEIIFDNDEDKTDSTALLPCIEQAREDIRTLRQLQFLQQNR

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
SF3001 NP_708775.1 hypothetical protein Not tested SHI-1 Protein 5e-22 96
unnamed AAK00484.1 unknown Not tested SHI-1 Protein 4e-22 96
z1225 CAD33791.1 Z1225 protein Not tested PAI I 536 Protein 1e-22 96
unnamed CAD66209.1 hypothetical protein Not tested PAI III 536 Protein 4e-22 94
ECO103_3594 YP_003223451.1 hypothetical protein Not tested LEE Protein 6e-21 93
ECO111_3780 YP_003236115.1 hypothetical protein Not tested LEE Protein 7e-22 91
unnamed ADD91697.1 hypothetical conserved protein Not tested PAI-I AL862 Protein 3e-21 91
unnamed CAI43850.1 hypothetical protein Not tested LEE Protein 2e-21 91
unnamed AAL08480.1 unknown Not tested SRL Protein 9e-22 90
Z1225 NP_286759.1 hypothetical protein Not tested TAI Protein 1e-21 90
Z1663 NP_287165.1 hypothetical protein Not tested TAI Protein 1e-21 90
unnamed CAE85206.1 hypothetical protein Not tested PAI V 536 Protein 1e-21 90
c5147 NP_756995.1 hypothetical protein Not tested PAI II CFT073 Protein 3e-21 88
unnamed AAL67387.1 L0009-like protein Not tested PAI II CFT073 Protein 2e-21 88
unnamed CAD42103.1 hypothetical protein Not tested PAI II 536 Protein 3e-21 88
Z5093 NP_290244.1 hypothetical protein Not tested LEE Protein 2e-15 86
unnamed AAC31488.1 L0009 Not tested LEE Protein 1e-15 86
ECs4541 NP_312568.1 hypothetical protein Not tested LEE Protein 2e-15 86
unnamed ACU09435.1 conserved hypothetical protein Not tested LEE Protein 1e-15 86

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
SeHA_C4674 YP_002048311.1 hypothetical protein VFG0665 Protein 2e-22 96
SeHA_C4674 YP_002048311.1 hypothetical protein VFG1532 Protein 5e-23 96
SeHA_C4674 YP_002048311.1 hypothetical protein VFG1684 Protein 2e-22 94
SeHA_C4674 YP_002048311.1 hypothetical protein VFG1071 Protein 4e-22 90
SeHA_C4674 YP_002048311.1 hypothetical protein VFG1622 Protein 1e-21 88
SeHA_C4674 YP_002048311.1 hypothetical protein VFG0788 Protein 5e-16 86