Gene Information

Name : Rpic_1788 (Rpic_1788)
Accession : YP_001899358.1
Strain :
Genome accession: NC_010682
Putative virulence/resistance : Resistance
Product : mercuric resistence transcriptional repressor, MerD, MerR family
Function : -
COG functional category : K : Transcription
COG ID : COG0789
EC number : -
Position : 1884087 - 1884449 bp
Length : 363 bp
Strand : +
Note : TIGRFAM: mercuric resistence transcriptional repressor protein MerD; PFAM: regulatory protein MerR; KEGG: sty:HCM1.159 putative mercuric resistance operon coregulator

DNA sequence :
ATGAATGCCTACACAGTGTCGCGTCTGGCCCACGATGCCAGCGTGAGCGTCAACGTGGTGCGTGACTATGCGCTGCGCGG
CCTGCTGCACCCCGCGCGCCGCACGGAGGGTGGCTATTGGCTCTACGATGCTCGGGCGCTGGCCAGATTGCGCTTCGTTC
GGGCTGCGTTCGAGGCCGGCATCGGCCTGGATGAACTGAGCCGCCTGTGTCGGGCGCTCGACGCGAACGATCGCGCCACC
TTGATCGAGTGTGTCGAGCAGTTAGGCCAGCAGATCGCGGCCCGGCAGGCAACATTGTGCGCGGTTAAGGCGGAACTGAA
CGAGCTGGCTTGCTGCGCCGACGAAGTTCGTGCCCCATCCTAG

Protein sequence :
MNAYTVSRLAHDASVSVNVVRDYALRGLLHPARRTEGGYWLYDARALARLRFVRAAFEAGIGLDELSRLCRALDANDRAT
LIECVEQLGQQIAARQATLCAVKAELNELACCADEVRAPS

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
merD AGK07078.1 MerD Not tested SGI1 Protein 1e-12 59
merD AGK07020.1 MerD Not tested SGI1 Protein 1e-12 59
merD ABQ57370.1 MerD Not tested SGI1 Protein 2e-12 58
merD CAJ77059.1 Mercury operon coregulator protein Not tested AbaR1 Protein 7e-16 58
merD YP_006098386.1 MerR family transcriptional regulator Not tested Tn2411 Protein 4e-12 57
merD ACF06181.1 mercuric resistance protein Not tested Tn5036-like Protein 3e-12 57
merD AET25396.1 MerD Not tested PAGI-2(C) Protein 3e-12 57
merD AFG30119.1 MerD Not tested PAGI-2 Protein 3e-12 57
merD ACN81004.1 MerD Not tested AbaR5 Protein 7e-16 55

• Homologs from CARD and BacMet (resistance genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
Rpic_1788 YP_001899358.1 mercuric resistence transcriptional repressor, MerD, MerR family BAC0668 Protein 5e-13 59
Rpic_1788 YP_001899358.1 mercuric resistence transcriptional repressor, MerD, MerR family BAC0666 Protein 7e-13 58
Rpic_1788 YP_001899358.1 mercuric resistence transcriptional repressor, MerD, MerR family BAC0227 Protein 9e-13 58
Rpic_1788 YP_001899358.1 mercuric resistence transcriptional repressor, MerD, MerR family BAC0665 Protein 1e-11 56
Rpic_1788 YP_001899358.1 mercuric resistence transcriptional repressor, MerD, MerR family BAC0667 Protein 2e-14 54
Rpic_1788 YP_001899358.1 mercuric resistence transcriptional repressor, MerD, MerR family BAC0669 Protein 2e-13 54