Gene Information

Name : -
Accession : -
Strain : Proteus mirabilis HI4320
Genome accession: NC_010554
Putative virulence/resistance : Unknown
Product : -
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2793715 - 2793766 bp
Length : 52 bp
Strand : +
Note : Repeat unit (5' end of tRNA Phe) generate by the insertion of mobile element. Also repeated downstream of PMI0323

DNA sequence :
AGGGGATTGAAAATCCCCGTGTCCTTGGTTCGATTCCGAGTCCGGGCACCAT

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
unnamed - - Not tested Not named DNA 5e-22 100
YEt076 - tRNA-Phe Not tested YAPI DNA 7e-21 100
unnamed - - Not tested YAPI DNA 7e-21 100
unnamed - - Not tested YAPI DNA 7e-21 100
unnamed - tRNA-Phe Not tested SPI-7 DNA 3e-20 98