
|
Name : - Accession : - Strain : Proteus mirabilis HI4320 Genome accession: NC_010554 Putative virulence/resistance : Unknown Product : - Function : - COG functional category : - COG ID : - EC number : - Position : 2793715 - 2793766 bp Length : 52 bp Strand : + Note : Repeat unit (5' end of tRNA Phe) generate by the insertion of mobile element. Also repeated downstream of PMI0323 DNA sequence : AGGGGATTGAAAATCCCCGTGTCCTTGGTTCGATTCCGAGTCCGGGCACCAT Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| unnamed | - | - | Not tested | Not named | DNA | 5e-22 | 100 |
| YEt076 | - | tRNA-Phe | Not tested | YAPI | DNA | 7e-21 | 100 |
| unnamed | - | - | Not tested | YAPI | DNA | 7e-21 | 100 |
| unnamed | - | - | Not tested | YAPI | DNA | 7e-21 | 100 |
| unnamed | - | tRNA-Phe | Not tested | SPI-7 | DNA | 3e-20 | 98 |