Gene Information

Name : EcSMS35_3227 (EcSMS35_3227)
Accession : -
Strain : Escherichia coli SMS-3-5
Genome accession: NC_010498
Putative virulence/resistance : Unknown
Product : -
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 3299416 - 3299715 bp
Length : 300 bp
Strand : -
Note : IS21 transposase orfA, degenerate; this region contains one or more premature stops and/or frameshifts which are not the result of sequencing error; identified by similarity to SP:P51026; match to protein family HMM PF01527

DNA sequence :
ATGATTGATGTCTTAGGACCGGAGAAACGCAGACGGCGTACTACACAGGAAAAGATCGCTATTGTTCAGCAGAGCTTTGA
ACAGGGAATGACGGTCTCCCTTGTTGCCCGGCAACACGGTGTGGCAGCCAGCCAGTTATTTCTCTGGCGCAAGCAATACC
AGGAGGGAAGTCTTACTGCTGTGGCTGCCGGAGAACAGGTCGTTCCTGCCTCTGAACTTGCTGCTGCCATGAAGCAGATT
AAAGAACTCCAGCGCCTGCTCGGCAAAAAAACGATGGAAAATGAAATCGGCTTTGTTTAA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
unnamed AAL67376.1 insertion sequence protein Not tested PAI II CFT073 DNA e-141 98.2
insC YP_002414034.1 IS2 insertion element repressor InsA; KpLE2 phage-like element Not tested Not named DNA e-141 98.2
tnpG AAD44740.1 TnpG Not tested SHI-2 DNA e-147 95.1
S3188 NP_838471.2 insertion sequence 2 OrfA protein Not tested SHI-1 DNA e-147 95.1
unnamed AAL57520.1 IS2 transposase Not tested LEE DNA e-146 94.7
S4060 NP_839229.2 insertion sequence 2 OrfA protein Not tested SHI-2 DNA e-146 94.7
S4049 NP_839217.2 insertion sequence 2 OrfA protein Not tested SHI-2 DNA e-147 94.7
ECO26_5247 YP_003232129.1 insertion sequence 2 OrfA protein Not tested LEE DNA e-145 94.4
st02 CAC81840.1 ST02 protein Not tested LEE II DNA e-145 94.4
unnamed - - Not tested LEE DNA e-139 94.4