|
Name : EcSMS35_2240 (EcSMS35_2240) Accession : YP_001744289.1 Strain : Escherichia coli SMS-3-5 Genome accession: NC_010498 Putative virulence/resistance : Virulence Product : hypothetical protein Function : - COG functional category : - COG ID : - EC number : - Position : 2262538 - 2262735 bp Length : 198 bp Strand : - Note : identified by match to protein family HMM PF06117 DNA sequence : ATGAAATCATTAACCACAGAAACGGCGCTGGATATTCTGATTGCGTGGCTGCAGGACAATATTGACTGCGAATCAGGGAT TATCTTCGACAACGATGAGGATAAAACGGATTCAGCAGCACTGCTGCCCTGCATTGAACAGGCCAGGGAAGATATCCGTA CCCTGCGCCAACAGCAGCTTCTGCAACAGAACAGGTGA Protein sequence : MKSLTTETALDILIAWLQDNIDCESGIIFDNDEDKTDSAALLPCIEQAREDIRTLRQQQLLQQNR |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| ECO103_3594 | YP_003223451.1 | hypothetical protein | Not tested | LEE | Protein | 3e-19 | 100 |
| ECO111_3780 | YP_003236115.1 | hypothetical protein | Not tested | LEE | Protein | 4e-19 | 99 |
| unnamed | AAK00484.1 | unknown | Not tested | SHI-1 | Protein | 1e-18 | 99 |
| SF3001 | NP_708775.1 | hypothetical protein | Not tested | SHI-1 | Protein | 2e-18 | 99 |
| unnamed | AAL08480.1 | unknown | Not tested | SRL | Protein | 5e-19 | 97 |
| Z1225 | NP_286759.1 | hypothetical protein | Not tested | TAI | Protein | 8e-19 | 97 |
| c5147 | NP_756995.1 | hypothetical protein | Not tested | PAI II CFT073 | Protein | 2e-18 | 95 |
| unnamed | AAL67387.1 | L0009-like protein | Not tested | PAI II CFT073 | Protein | 1e-18 | 95 |
| unnamed | ADD91697.1 | hypothetical conserved protein | Not tested | PAI-I AL862 | Protein | 2e-19 | 94 |
| unnamed | CAI43850.1 | hypothetical protein | Not tested | LEE | Protein | 1e-19 | 94 |
| unnamed | AAC31488.1 | L0009 | Not tested | LEE | Protein | 2e-16 | 89 |
| unnamed | ACU09435.1 | conserved hypothetical protein | Not tested | LEE | Protein | 2e-16 | 89 |
| Z5093 | NP_290244.1 | hypothetical protein | Not tested | LEE | Protein | 3e-16 | 89 |
| ECs4541 | NP_312568.1 | hypothetical protein | Not tested | LEE | Protein | 3e-16 | 89 |
| Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
| EcSMS35_2240 | YP_001744289.1 | hypothetical protein | VFG0665 | Protein | 5e-19 | 99 |
| EcSMS35_2240 | YP_001744289.1 | hypothetical protein | VFG1071 | Protein | 2e-19 | 97 |
| EcSMS35_2240 | YP_001744289.1 | hypothetical protein | VFG0788 | Protein | 9e-17 | 89 |
