Gene Information

Name : EcSMS35_2240 (EcSMS35_2240)
Accession : YP_001744289.1
Strain : Escherichia coli SMS-3-5
Genome accession: NC_010498
Putative virulence/resistance : Virulence
Product : hypothetical protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2262538 - 2262735 bp
Length : 198 bp
Strand : -
Note : identified by match to protein family HMM PF06117

DNA sequence :
ATGAAATCATTAACCACAGAAACGGCGCTGGATATTCTGATTGCGTGGCTGCAGGACAATATTGACTGCGAATCAGGGAT
TATCTTCGACAACGATGAGGATAAAACGGATTCAGCAGCACTGCTGCCCTGCATTGAACAGGCCAGGGAAGATATCCGTA
CCCTGCGCCAACAGCAGCTTCTGCAACAGAACAGGTGA

Protein sequence :
MKSLTTETALDILIAWLQDNIDCESGIIFDNDEDKTDSAALLPCIEQAREDIRTLRQQQLLQQNR

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
ECO103_3594 YP_003223451.1 hypothetical protein Not tested LEE Protein 3e-19 100
ECO111_3780 YP_003236115.1 hypothetical protein Not tested LEE Protein 4e-19 99
unnamed AAK00484.1 unknown Not tested SHI-1 Protein 1e-18 99
SF3001 NP_708775.1 hypothetical protein Not tested SHI-1 Protein 2e-18 99
Z1225 NP_286759.1 hypothetical protein Not tested TAI Protein 8e-19 97
unnamed AAL08480.1 unknown Not tested SRL Protein 5e-19 97
unnamed AAL67387.1 L0009-like protein Not tested PAI II CFT073 Protein 1e-18 95
c5147 NP_756995.1 hypothetical protein Not tested PAI II CFT073 Protein 2e-18 95
unnamed ADD91697.1 hypothetical conserved protein Not tested PAI-I AL862 Protein 2e-19 94
unnamed CAI43850.1 hypothetical protein Not tested LEE Protein 1e-19 94
unnamed AAC31488.1 L0009 Not tested LEE Protein 2e-16 89
unnamed ACU09435.1 conserved hypothetical protein Not tested LEE Protein 2e-16 89
Z5093 NP_290244.1 hypothetical protein Not tested LEE Protein 3e-16 89
ECs4541 NP_312568.1 hypothetical protein Not tested LEE Protein 3e-16 89

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
EcSMS35_2240 YP_001744289.1 hypothetical protein VFG0665 Protein 5e-19 99
EcSMS35_2240 YP_001744289.1 hypothetical protein VFG1071 Protein 2e-19 97
EcSMS35_2240 YP_001744289.1 hypothetical protein VFG0788 Protein 9e-17 89