Gene Information

Name : trwL3 (Btr_2513)
Accession : YP_001610470.1
Strain : Bartonella tribocorum CIP 105476
Genome accession: NC_010161
Putative virulence/resistance : Virulence
Product : TrwL3 protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2443390 - 2443707 bp
Length : 318 bp
Strand : +
Note : Component of type IV secretion system; hypothetical protein

DNA sequence :
ATGAAACAATTAGATATTCTTCAAACAATAGTTCGTAAAAAAAACACTTCAATCTCTACAGCTTTAACTGTATTCTTTAT
GAATAATTCCGCATATGCCCAACCGAGGTATTTGACAAATGCAAATAACGCTTTAGAGCGCTTAAAGGGCGATTTAAACA
TTATTATCCCTATTGCCGCCGGTGTTATACTTTTATGTCTAGCAATTGCTTATGCGGGGAGATACATCGAAAAAAGTACG
TTCATACGATGGGCAGTTGGCGTTGTTGTAGCTGGTTCAGCATCCCAACTTGCTACACTGTTATTTAATCGAGTTTAA

Protein sequence :
MKQLDILQTIVRKKNTSISTALTVFFMNNSAYAQPRYLTNANNALERLKGDLNIIIPIAAGVILLCLAIAYAGRYIEKST
FIRWAVGVVVAGSASQLATLLFNRV

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
trwL3 CAD42838.1 TrwL3 protein Not tested trw-PAI Protein 7e-38 100
trwL3 YP_001610470.1 TrwL3 protein Virulence Not named Protein 1e-37 100
trwL2 YP_001610469.1 TrwL2 protein Virulence Not named Protein 6e-31 86
trwL2 CAD42837.1 TrwL2 protein Not tested trw-PAI Protein 4e-31 86
trwL5 CAD42840.1 TrwL5 protein Not tested trw-PAI Protein 1e-28 80
trwL5 YP_001610472.1 TrwL5 protein Virulence Not named Protein 1e-28 80
trwL4 CAD42839.1 TrwL4 protein Not tested trw-PAI Protein 7e-28 78
trwL4 YP_001610471.1 TrwL4 protein Virulence Not named Protein 9e-28 78
trwL1 YP_001610468.1 TrwL1 protein Virulence Not named Protein 1e-28 77
trwL1 CAD42836.1 TrwL1 protein Not tested trw-PAI Protein 8e-29 77
trwL6 CAD42841.1 TrwL6 protein Not tested trw-PAI Protein 2e-26 75
trwL6 YP_001610473.1 TrwL6 protein Virulence Not named Protein 3e-26 75

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
trwL3 YP_001610470.1 TrwL3 protein VFG2256 Protein 2e-21 59
trwL3 YP_001610470.1 TrwL3 protein VFG2254 Protein 9e-20 58
trwL3 YP_001610470.1 TrwL3 protein VFG2251 Protein 1e-20 58
trwL3 YP_001610470.1 TrwL3 protein VFG2255 Protein 3e-19 57
trwL3 YP_001610470.1 TrwL3 protein VFG2252 Protein 7e-16 56
trwL3 YP_001610470.1 TrwL3 protein VFG2250 Protein 5e-19 55
trwL3 YP_001610470.1 TrwL3 protein VFG2253 Protein 2e-21 54