|
Name : Bmul_2271 (Bmul_2271) Accession : YP_001580453.1 Strain : Genome accession: NC_010084 Putative virulence/resistance : Resistance Product : mercuric transport protein periplasmic component Function : - COG functional category : P : Inorganic ion transport and metabolism COG ID : COG2608 EC number : - Position : 2485297 - 2485581 bp Length : 285 bp Strand : + Note : TIGRFAM: mercuric transport protein periplasmic component; PFAM: Heavy metal transport/detoxification protein; KEGG: ajs:Ajs_1476 mercuric transport protein periplasmic component DNA sequence : GTGAAAAAACTCGTTGCCCTGGCGGCGTTGGCCGCGATGACCTCGCCCGTCTGGGCTGCCACCCAGAGCGTCACGCTGTC CGTGCCGGGCATGAACTGCGCCACTTGCCCGATCACGGTCAAGAAAGCGCTGACCAAGGTTTCCGGCGTCAGCAAGATCG ACGTGAGCCTGGATCGACGTGAGGCTAGGGTCACGTTCGATGATGCGAAGGCGAACGTCGAGGCCCTCACACGCGCCACA AAGGACGCAGGTTTTCCGTCCACTTTGGTGGGAGCCGCCAAATGA Protein sequence : MKKLVALAALAAMTSPVWAATQSVTLSVPGMNCATCPITVKKALTKVSGVSKIDVSLDRREARVTFDDAKANVEALTRAT KDAGFPSTLVGAAK |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| merP | ACN81007.1 | MerP periplasmic mercuric ion binding protein | Not tested | AbaR5 | Protein | 2e-20 | 74 |
| merP | CAJ77062.1 | Periplasmic mercuric ion binding protein | Not tested | AbaR1 | Protein | 2e-20 | 74 |
| merP | AGK07023.1 | MerP | Not tested | SGI1 | Protein | 8e-21 | 70 |
| merP | AGK07081.1 | MerP | Not tested | SGI1 | Protein | 8e-21 | 70 |
| merP | YP_006098389.1 | mercuric ion transport protein | Not tested | Tn2411 | Protein | 1e-20 | 70 |
| merP | ABQ57373.1 | MerP | Not tested | SGI1 | Protein | 8e-21 | 70 |
| merP | AET25399.1 | MerP | Not tested | PAGI-2(C) | Protein | 8e-21 | 70 |
| merP | AFG30122.1 | MerP | Not tested | PAGI-2 | Protein | 8e-21 | 70 |
| unnamed | ABR13399.1 | copper-transporting ATPase 2 | Not tested | PAGI-5 | Protein | 5e-23 | 69 |
| merP | AAN62179.1 | periplasmic mercuric ion binding protein MerP | Not tested | PAGI-2(C) | Protein | 4e-19 | 66 |
| Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
| Bmul_2271 | YP_001580453.1 | mercuric transport protein periplasmic component | BAC0679 | Protein | 1e-19 | 70 |
| Bmul_2271 | YP_001580453.1 | mercuric transport protein periplasmic component | BAC0678 | Protein | 3e-20 | 68 |
| Bmul_2271 | YP_001580453.1 | mercuric transport protein periplasmic component | BAC0675 | Protein | 4e-19 | 68 |
| Bmul_2271 | YP_001580453.1 | mercuric transport protein periplasmic component | BAC0231 | Protein | 2e-20 | 67 |
| Bmul_2271 | YP_001580453.1 | mercuric transport protein periplasmic component | BAC0674 | Protein | 2e-19 | 57 |
