
|
Name : rpmG (RBAM_001240) Accession : YP_001419778.1 Strain : Bacillus amyloliquefaciens FZB42 Genome accession: NC_009725 Putative virulence/resistance : Unknown Product : 50S ribosomal protein L33 Function : - COG functional category : J : Translation, ribosomal structure and biogenesis COG ID : COG0267 EC number : - Position : 118078 - 118227 bp Length : 150 bp Strand : + Note : in Escherichia coli BM108, a mutation that results in lack of L33 synthesis had no effect on ribosome synthesis or function; there are paralogous genes in several bacterial genomes, and a CXXC motif for zinc binding and an upstream regulation region of th DNA sequence : ATGAGAAAAAAGATTACGCTGGCATGCAAAACATGCGGAAATCGTAATTATACGACAATGAAAAGCTCTGCATCAGCGGC TGAGCGGTTAGAAGTTAAGAAGTACTGCAGCACTTGCAATTCACATACAGCTCATTTAGAAACAAAATAG Protein sequence : MRKKITLACKTCGNRNYTTMKSSASAAERLEVKKYCSTCNSHTAHLETK |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| ef0106 | AAM75309.1 | EF0106 | Not tested | Not named | Protein | 0.001 | 44 |
| rpmG | NP_814353.1 | 50S ribosomal protein L33 | Not tested | Not named | Protein | 0.002 | 44 |