
|
Name : rpmE2 (YpsIP31758_3069) Accession : YP_001402029.1 Strain : Yersinia pseudotuberculosis IP 31758 Genome accession: NC_009708 Putative virulence/resistance : Unknown Product : 50S ribosomal protein L31 Function : - COG functional category : J : Translation, ribosomal structure and biogenesis COG ID : COG0254 EC number : - Position : 3457724 - 3457984 bp Length : 261 bp Strand : + Note : RpmE2; there appears to be two types of ribosomal proteins L31 in bacterial genomes; some contain a CxxC motif while others do not; Bacillus subtilis has both types; the proteins in this cluster do not have the CXXC motif; RpmE is found in exponentially g DNA sequence : ATGAAGCCCAATATCCACCCTCCGTATCGGACTGTGGTATTTCACGATACCAGTGCGGATGCTTATTTTACTGTAGGTTC AACCATTGCCACTGAGCGAACAATCGAACGCGATGGCCAGACGTACCCCTACGTCACATTAGATATCTCTTCAGCCTCGC ATCCGTACTACACCGGTAAGCAAAAAGAGTTTGCTAAAGAAGGCAGTACCGCACGCTTCCACCAACGTTTCGGTAGTTTC TTAACAAAGAAAACCAACTAA Protein sequence : MKPNIHPPYRTVVFHDTSADAYFTVGSTIATERTIERDGQTYPYVTLDISSASHPYYTGKQKEFAKEGSTARFHQRFGSF LTKKTN |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| rpmE2 | NP_287095.1 | 50S ribosomal protein L31 | Not tested | TAI | Protein | 9e-24 | 68 |
| rpmE2 | NP_286687.1 | 50S ribosomal protein L31 | Not tested | TAI | Protein | 9e-24 | 68 |