Gene Information

Name : -
Accession : -
Strain :
Genome accession: NC_009140
Putative virulence/resistance : Unknown
Product : -
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 142095 - 142861 bp
Length : 767 bp
Strand : +
Note : -

DNA sequence :
TACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCG
TAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGTTGATTA
TCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCAC
CGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGTGGGATCTGCCA
CTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGA
CAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGC
CACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCG
GTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGC
AGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGC
AAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
tpnIS26 ADZ05794.1 transposase Not tested AbaR16 DNA 0.0 100
unnamed - - Not tested AbaR16 DNA 0.0 100
unnamed - - Not tested AbaR12 DNA 0.0 100
tpnIS26 ADZ05778.1 transposase Not tested AbaR12 DNA 0.0 100
tnp26 AGK36641.1 transposase of IS26 Not tested AbaR26 DNA 0.0 100
tpnIS26 ADZ05810.1 transposase Not tested AbaR20 DNA 0.0 100
IS26 CAJ77078.1 Insertion sequence Not tested AbaR1 DNA 0.0 100
tnpA26 ACN81016.1 transposase of IS26 Not tested AbaR5 DNA 0.0 100
tnpA26 AFV53109.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 100
tnpA26 ACV89829.1 transposase of IS26 Not tested AbaR6 DNA 0.0 100
tnpA26 ACV89831.1 transposase of IS26 Not tested AbaR7 DNA 0.0 100
tpnIS26 ADZ05796.1 transposase Not tested AbaR17 DNA 0.0 100
tnpA26 ADK35781.1 transposase of IS26 Not tested AbaR8 DNA 0.0 100
tpnIS26 ADZ05798.1 transposase Not tested AbaR18 DNA 0.0 100
Pmu_03480 YP_005176246.1 IS26 transposase Not tested ICEPmu1 DNA 0.0 100
unnamed - - Not tested AbaR26 DNA 0.0 100
IS15 CAJ77077.1 Insertion sequence Not tested AbaR1 DNA 0.0 100
ABTW07_3872 YP_005797120.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA 0.0 99.9
tpnIS26 ADZ05784.1 transposase Not tested AbaR14 DNA 0.0 99.9
ABTW07_3875 YP_005797123.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA 0.0 99.9
tnp26 AGK36639.1 transposase of IS26 Not tested AbaR26 DNA 0.0 99.9
ABTW07_3890 YP_005797138.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA 0.0 99.9
ABTW07_3906 YP_005797154.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA 0.0 99.9
ABTW07_3877 YP_005797125.1 transposase IS26 Not tested AbaR4e DNA 0.0 99.8
ABTW07_3892 YP_005797140.1 transposase IS26 Not tested AbaR4e DNA 0.0 99.8
Pmu_03450 YP_005176243.1 IS26 transposase Not tested ICEPmu1 DNA 0.0 99.7
tnpA26 AGK07092.1 IS26 transposase Not tested SGI1 DNA 0.0 99.6
unnamed - - Not tested AbaR19 DNA 0.0 99.6
IS26 CAJ77074.1 Insertion sequence Not tested AbaR1 DNA 0.0 99.6
tnpA26 ACN81018.1 transposase of IS26 Not tested AbaR5 DNA 0.0 99.6
tnpA26 AGK07095.1 IS26 transposase Not tested SGI1 DNA 0.0 99.6
tpnIS26 ADZ05788.1 transposase Not tested AbaR15 DNA 0.0 99.6
tnpA26 AGK07097.1 IS26 transposase Not tested SGI1 DNA 0.0 99.6
tnpA AET25383.1 TnpA Not tested PAGI-2(C) DNA 0.0 99.6
unnamed - - Not tested AbaR15 DNA 0.0 99.6
tnpA26 ACN81013.1 transposase of IS26 Not tested AbaR5 DNA 0.0 99.6
tnpA AFG30106.1 TnpA Not tested PAGI-2 DNA 0.0 99.6
tnp7109-28 YP_001800928.1 transposase for insertion sequence Not tested Not named DNA 0.0 99.6
tnpA26 AFV53110.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 99.6
unnamed AEZ06025.1 TnpA26, Transposase of IS26 Not tested AbaR24 DNA 0.0 99.6
tnp7109-29 YP_001800930.1 transposase for insertion sequence Not tested Not named DNA 0.0 99.6
tnpA26 AFV53107.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 99.6
tnpA26 AGK07034.1 IS26 transposase Not tested SGI1 DNA 0.0 99.6
tnpA26 AFV53122.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 99.6
tnpA26 AGK07037.1 IS26 transposase Not tested SGI1 DNA 0.0 99.6
tnpA26 ACK44541.1 TnpA Not tested SGI1 DNA 0.0 99.6
tnpA26 AFV53108.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 99.6
tnpA26 AGK07039.1 IS26 transposase Not tested SGI1 DNA 0.0 99.6
tpnIS26 ADZ05800.1 transposase Not tested AbaR19 DNA 0.0 99.6
tnpA26 ACK44543.1 TnpA Not tested SGI1 DNA 0.0 99.6
IS26 CAJ77080.1 Insertion sequence Not tested AbaR1 DNA 0.0 99.5