Gene Information

Name : HEAR1541 (HEAR1541)
Accession : YP_001099833.1
Strain : Herminiimonas arsenicoxydans
Genome accession: NC_009138
Putative virulence/resistance : Resistance
Product : regulatory protein MerR
Function : -
COG functional category : K : Transcription
COG ID : COG0789
EC number : -
Position : 1531143 - 1531580 bp
Length : 438 bp
Strand : -
Note : Evidence 3 : Function proposed based on presence of conserved amino acid motif, structural feature or limited homology; Product type pr : regulator

DNA sequence : 
TTGAGCAATGAAAAACTGAAGATCGGTGAATTGGCCAAACATGCCCATTGCCAGATAGCCACGATTCGTTATTACGAACA
GGAAGGTCTGCTATCCGCACCGGCGCGTAATGAAGCGAACTATCGCATTTATGGTAGAGAGCATGTAGAGCGTTTGTCCC
TTATACGACATTGCCGTTCGCTTGACATGACGTTGAACGAAATCCGTACCTTGCTTCGATTCCGCGACGCACCTGAAGAC
AATTGCGGCGAGGTCAACACATTACTCGATGCTCACATCGGTCATGTTGCCCAGCGTATCGCCAGTTTAAAGGCGTTGGA
AAAGCAGTTGAAAGAACTGCGTCAACTCTGTAATACGACACGAACAGCCAAAAACTGCGGCATATTGAACGACTTGGCAG
TTGAGGCCAATACGGCTAGAGACGCGATTACTGAATAG

Protein sequence : 
MSNEKLKIGELAKHAHCQIATIRYYEQEGLLSAPARNEANYRIYGREHVERLSLIRHCRSLDMTLNEIRTLLRFRDAPED
NCGEVNTLLDAHIGHVAQRIASLKALEKQLKELRQLCNTTRTAKNCGILNDLAVEANTARDAITE

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
ORF C98 AAN62191.1 putative transcriptional regulator Not tested PAGI-2(C) Protein 1e-35 55
cadR ACS32041.1 MerR family transcriptional regulator Not tested AbaR5 Protein 9e-33 50
cadR ADZ05769.1 MerR family transcriptional regulator Not tested AbaR11 Protein 6e-33 50
pbrR CAJ77021.1 transcription regulator Not tested AbaR1 Protein 1e-33 49
ACICU_00234 YP_001844893.1 transcriptional regulator Not tested AbaR20 Protein 3e-32 49
cadR ACN81029.1 MerR family transcriptional regulator Not tested AbaR5 Protein 7e-33 48
pbrR CAJ77094.1 Transcriptional regulator Not tested AbaR1 Protein 5e-33 48
cadR AGK36653.1 MerR family transcriptional regulator Not tested AbaR26 Protein 5e-33 48

• Homologs from CARD and BacMet (resistance genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
HEAR1541 YP_001099833.1 regulatory protein MerR BAC0301 Protein 5e-36 64
HEAR1541 YP_001099833.1 regulatory protein MerR BAC0058 Protein 6e-38 56