|
Name : YEt076 (YEt076) Accession : - Strain : Yersinia enterocolitica 8081 Genome accession: NC_008800 Putative virulence/resistance : Unknown Product : tRNA-Phe Function : - COG functional category : - COG ID : - EC number : - Position : 3828040 - 3828092 bp Length : 53 bp Strand : - Note : duplicated fragment of tRNA-phe thought to be associated with insertion of YAPI pathogenicity island DNA sequence : AATATGGTGCCCGGACTCGGAATCGAACCAAGGACACGGGGATTTTCAATCCC Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| YEt076 | - | tRNA-Phe | Not tested | YAPI | DNA | 1e-22 | 100 |
| unnamed | - | - | Not tested | Not named | DNA | 7e-21 | 100 |
| unnamed | - | - | Not tested | YAPI | DNA | 7e-21 | 100 |
| unnamed | - | - | Not tested | YAPI | DNA | 7e-21 | 100 |
| unnamed | - | tRNA-Phe | Not tested | SPI-7 | DNA | 5e-19 | 98 |
