Gene Information

Name : SAUSA300_0057 (SAUSA300_0057)
Accession : YP_492776.1
Strain : Staphylococcus aureus FPR3757
Genome accession: NC_007793
Putative virulence/resistance : Unknown
Product : hypothetical protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 66234 - 66545 bp
Length : 312 bp
Strand : -
Note : identified by match to protein family HMM PF06124

DNA sequence :
ATGAAAATCAATCGATACATCACAAGAGGCATTAGTGAACAACTATCTCTAGACCTTCAAATCTTACTTTGGAACATGGT
AAAAGATCGAGACAATCAACTTAATACAGATTACCTACACATTTTCAAACTACAAGAAGATGATAATATGTTGTCAATTA
CACATGAACAAGAACAACCCGCATACAAATTGGAATATCACTATACAAACTATATAAAAAATCAAAATGCATTACCTAAG
AAAGTCTACGTCATCCGAGAAGATGATGTAGACGCTTTTTATTATGTGATGCTTTTGCCAGAAGAATACTAA

Protein sequence :
MKINRYITRGISEQLSLDLQILLWNMVKDRDNQLNTDYLHIFKLQEDDNMLSITHEQEQPAYKLEYHYTNYIKNQNALPK
KVYVIREDDVDAFYYVMLLPEEY

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
SAS0030 YP_042163.1 hypothetical protein Not tested SCC476 Protein 3e-41 96
unnamed BAG06214.1 hypothetical protein Not tested Type-VII SCCmec Protein 3e-42 96
unnamed BAB83490.1 - Not tested SCC 12263 Protein 3e-41 94
SAR0057 YP_039528.1 hypothetical protein Not tested Type-II SCCmec Protein 8e-40 93
SAV0059 NP_370583.1 hypothetical protein Not tested Type-II SCCmec Protein 8e-40 93
SA0055 NP_373295.1 hypothetical protein Not tested Type-II SCCmec Protein 8e-40 93
SERP2503 YP_190045.1 hypothetical protein Not tested Type-II SCCmec Protein 8e-40 93
unnamed BAA94662.1 - Not tested Type-II SCCmec Protein 6e-40 93
SE0031 NP_763586.1 hypothetical protein Not tested SCCpbp4 Protein 1e-40 93
SE0053 NP_763608.1 hypothetical protein Not tested SCCpbp4 Protein 1e-40 92
unnamed ACL99846.1 hypothetical protein Not tested Type-V SCCmec Protein 2e-39 91
unnamed BAB46980.2 hypothetical protein Not tested Type-IIIinv SCCmec Protein 2e-38 90
SACOL0038 YP_184949.1 hypothetical protein Not tested Type-I SCCmec Protein 1e-39 89
SH0058 YP_251973.1 hypothetical protein Not tested SCCmec Protein 3e-39 89
unnamed BAA94330.1 hypothetical protein Not tested Type-I SCCmec Protein 6e-40 89
unnamed BAB72130.1 hypothetical protein Not tested Type-IVb SCCmec Protein 2e-38 87
unnamed BAC67563.1 hypothetical protein Not tested Type-IVc SCCmec Protein 2e-38 87
SAMSHR1132_00370 YP_005324561.1 hypothetical protein Not tested Type-IIIinv SCCmec Protein 2e-38 87
MW0036 NP_644851.1 hypothetical protein Not tested Type-IV SCCmec Protein 2e-38 87
unnamed BAB72111.1 hypothetical protein Not tested Type-IVa SCCmec Protein 2e-38 87
unnamed BAD24837.1 hypothetical protein Not tested Type-V SCCmec Protein 1e-38 86
SAPIG0052 YP_005732862.1 hypothetical protein Not tested Type-V SCCmec Protein 6e-39 85
SSP0048 YP_300138.1 hypothetical protein Not tested SCC15305cap Protein 1e-17 51
unnamed BAB47670.1 hypothetical protein Not tested Type-III SCCmec Protein 3e-16 50
SAPIG0036 YP_005732846.1 hypothetical protein Not tested Type-V SCCmec Protein 4e-16 50
unnamed BAC53832.1 hypothetical protein Not tested SRImec-III and SCCmec-III region Protein 3e-16 50
unnamed ACL99834.1 hypothetical protein Not tested Type-V SCCmec Protein 2e-16 50
unnamed BAG06193.1 hypothetical protein Not tested Type-VII SCCmec Protein 2e-16 50
SARLGA251_00340 YP_005754049.1 hypothetical protein Not tested Type-XI SCCmec Protein 1e-15 49
unnamed BAB47601.1 hypothetical protein Not tested Type-III SCCmec Protein 1e-15 49
SSP0032 YP_300122.1 hypothetical protein Not tested SCC15305RM Protein 2e-14 46
unnamed AAL26664.1 unknown Not tested SCCcap1 Protein 6e-11 44