Gene Information

Name : SAUSA300_1748 (SAUSA300_1748)
Accession : -
Strain : Staphylococcus aureus FPR3757
Genome accession: NC_007793
Putative virulence/resistance : Unknown
Product : -
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 1928771 - 1928914 bp
Length : 144 bp
Strand : -
Note : transposase, authentic frameshift; this gene contains a frame shift which is not the result of sequencing error

DNA sequence :
ATGACAAGAGAAAGAAGATCATTTAGTTCAGAGTTTAAGTTACAAATGGTTAGATTATATAAAAATGGTAAGCCTAGGAA
TGAAATTATACGCGAGTATGATTTCACACCTTCGACGTTTGTAAATGGCGGTTATAAAATGTAG

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
SAUSA300_1748 - - Not tested vSa¥â DNA 1e-74 100
NWMN_1695 YP_001332729.1 putative transposase Not tested vSa¥â DNA 1e-74 100
MW1747 NP_646564.1 putative transposase Not tested vSa¥â DNA 1e-74 100