Gene Information

Name : fliQ (RPB_3774)
Accession : YP_487379.1
Strain : Rhodopseudomonas palustris HaA2
Genome accession: NC_007778
Putative virulence/resistance : Virulence
Product : flagellar biosynthesis protein FliQ
Function : -
COG functional category : N : Cell motility
COG ID : COG1987
EC number : -
Position : 4310152 - 4310415 bp
Length : 264 bp
Strand : -
Note : FliQ, with proteins FliP and FliR, forms the core of the central channel in the flagella export apparatus; Bradyrhizobium have one thick flagellum and several thin flagella; the protein in this cluster is associated with the thick flagellum

DNA sequence :
ATGACCGGTGCTGAAACTCTCGATATCGCCCGCGAAGCGGTCTGGACGATCGTGATCGTCTCGGCACCGCTGATGGTGGT
CGGCCTGGTCGTCGGCGTGGCGGTGTCGCTGGTCCAGGCGCTGACCCAGATCCAGGAACAGACGCTGGTGTTCGTCCCGA
AGATTCTGGCGATGTTCCTCACCTTGGTGCTGACGCTGCCGTTCATGGCCGACCGGCTGCACGCCGAAATGCTGCGGATC
TCATCGCGAATCGTCGGCGGTTGA

Protein sequence :
MTGAETLDIAREAVWTIVIVSAPLMVVGLVVGVAVSLVQALTQIQEQTLVFVPKILAMFLTLVLTLPFMADRLHAEMLRI
SSRIVGG

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
hrcS AAT96263.1 HrcS Virulence S-PAI Protein 2.2 48
hrcS AAT96304.1 HrcS Virulence S-PAI Protein 2.2 48
hrcS AAT96344.1 HrcS Virulence S-PAI Protein 2.2 48
hrcS ABA47280.1 HrcS Virulence S-PAI Protein 2.7 45
ssaS NP_460385.1 type III secretion system apparatus protein Virulence SPI-2 Protein 0.031 42
ssaS CAA68200.1 secretion system apparatus, SsaS Virulence SPI-2 Protein 0.022 42
ssaS NP_456108.1 putative type III secretion protein Virulence SPI-2 Protein 0.039 42
ssaS NP_805091.1 type III secretion protein Virulence SPI-2 Protein 0.039 42
ssaS YP_216428.1 secretion system apparatus protein SsaS Virulence SPI-2 Protein 0.031 42
lscS AAO18039.1 LscS Virulence TTSS locus Protein 0.003 42
escS CAC81848.1 EscS protein Virulence LEE II Protein 0.022 42
escS YP_003223489.1 T3SS structure protein EscS Virulence LEE Protein 0.032 42
escS AAK26701.1 EscS Virulence LEE Protein 0.022 42
escS YP_003232139.1 T3SS structure protein EscS Virulence LEE Protein 0.032 42
escS AAL57528.1 EscS Virulence LEE Protein 0.022 42
hrcS AAB06006.1 HrcS Virulence Hrp PAI Protein 9.1 41

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
fliQ YP_487379.1 flagellar biosynthesis protein FliQ VFG0395 Protein 5e-04 44
fliQ YP_487379.1 flagellar biosynthesis protein FliQ VFG0520 Protein 0.009 42