Gene Information

Name : fliQ (RPB_3774)
Accession : YP_487379.1
Strain : Rhodopseudomonas palustris HaA2
Genome accession: NC_007778
Putative virulence/resistance : Virulence
Product : flagellar biosynthesis protein FliQ
Function : -
COG functional category : N : Cell motility
COG ID : COG1987
EC number : -
Position : 4310152 - 4310415 bp
Length : 264 bp
Strand : -
Note : FliQ, with proteins FliP and FliR, forms the core of the central channel in the flagella export apparatus; Bradyrhizobium have one thick flagellum and several thin flagella; the protein in this cluster is associated with the thick flagellum

DNA sequence :
ATGACCGGTGCTGAAACTCTCGATATCGCCCGCGAAGCGGTCTGGACGATCGTGATCGTCTCGGCACCGCTGATGGTGGT
CGGCCTGGTCGTCGGCGTGGCGGTGTCGCTGGTCCAGGCGCTGACCCAGATCCAGGAACAGACGCTGGTGTTCGTCCCGA
AGATTCTGGCGATGTTCCTCACCTTGGTGCTGACGCTGCCGTTCATGGCCGACCGGCTGCACGCCGAAATGCTGCGGATC
TCATCGCGAATCGTCGGCGGTTGA

Protein sequence :
MTGAETLDIAREAVWTIVIVSAPLMVVGLVVGVAVSLVQALTQIQEQTLVFVPKILAMFLTLVLTLPFMADRLHAEMLRI
SSRIVGG

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
hrcS AAT96263.1 HrcS Virulence S-PAI Protein 2.2 48
hrcS AAT96304.1 HrcS Virulence S-PAI Protein 2.2 48
hrcS AAT96344.1 HrcS Virulence S-PAI Protein 2.2 48
hrcS ABA47280.1 HrcS Virulence S-PAI Protein 2.7 45
ssaS NP_456108.1 putative type III secretion protein Virulence SPI-2 Protein 0.039 42
ssaS NP_805091.1 type III secretion protein Virulence SPI-2 Protein 0.039 42
ssaS YP_216428.1 secretion system apparatus protein SsaS Virulence SPI-2 Protein 0.031 42
ssaS NP_460385.1 type III secretion system apparatus protein Virulence SPI-2 Protein 0.031 42
ssaS CAA68200.1 secretion system apparatus, SsaS Virulence SPI-2 Protein 0.022 42
lscS AAO18039.1 LscS Virulence TTSS locus Protein 0.003 42
escS YP_003223489.1 T3SS structure protein EscS Virulence LEE Protein 0.032 42
escS AAK26701.1 EscS Virulence LEE Protein 0.022 42
escS YP_003232139.1 T3SS structure protein EscS Virulence LEE Protein 0.032 42
escS AAL57528.1 EscS Virulence LEE Protein 0.022 42
escS CAC81848.1 EscS protein Virulence LEE II Protein 0.022 42
hrcS AAB06006.1 HrcS Virulence Hrp PAI Protein 9.1 41

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
fliQ YP_487379.1 flagellar biosynthesis protein FliQ VFG0395 Protein 5e-04 44
fliQ YP_487379.1 flagellar biosynthesis protein FliQ VFG0520 Protein 0.009 42