Gene Information

Name : -
Accession : -
Strain :
Genome accession: NC_006856
Putative virulence/resistance : Unknown
Product : -
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 9101 - 9923 bp
Length : 823 bp
Strand : +
Note : repeat001 copy 1

DNA sequence :
TGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAG
GCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAG
GAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGA
AAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAAGG
GCCGCGTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACGGTCGATTTTTATCTCTCCTCCCGTCGTAACAG
CAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATA
AAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATT
AAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCAT
GAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATG
GTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCA
TCGCTAACTTTGCAACAGTGCCT

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
tnpA26 AFV53107.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 99.7
tnpA26 AGK07034.1 IS26 transposase Not tested SGI1 DNA 0.0 99.7
tnp7109-28 YP_001800928.1 transposase for insertion sequence Not tested Not named DNA 0.0 99.7
tnpA26 AFV53122.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 99.7
tnpA26 AGK07037.1 IS26 transposase Not tested SGI1 DNA 0.0 99.7
tnpA26 ACK44541.1 TnpA Not tested SGI1 DNA 0.0 99.7
tnp7109-29 YP_001800930.1 transposase for insertion sequence Not tested Not named DNA 0.0 99.7
tnpA26 AFV53108.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 99.7
tnpA26 AGK07039.1 IS26 transposase Not tested SGI1 DNA 0.0 99.7
tpnIS26 ADZ05800.1 transposase Not tested AbaR19 DNA 0.0 99.7
tnpA26 ACK44543.1 TnpA Not tested SGI1 DNA 0.0 99.7
tnpA26 AGK07092.1 IS26 transposase Not tested SGI1 DNA 0.0 99.7
unnamed - - Not tested AbaR19 DNA 0.0 99.7
IS26 CAJ77074.1 Insertion sequence Not tested AbaR1 DNA 0.0 99.7
tnpA26 AGK07095.1 IS26 transposase Not tested SGI1 DNA 0.0 99.7
tpnIS26 ADZ05788.1 transposase Not tested AbaR15 DNA 0.0 99.7
tnpA26 AGK07097.1 IS26 transposase Not tested SGI1 DNA 0.0 99.7
tnpA AET25383.1 TnpA Not tested PAGI-2(C) DNA 0.0 99.7
unnamed - - Not tested AbaR15 DNA 0.0 99.7
IS26 CAJ77080.1 Insertion sequence Not tested AbaR1 DNA 0.0 99.7
tnpA26 ACN81018.1 transposase of IS26 Not tested AbaR5 DNA 0.0 99.7
tnpA AFG30106.1 TnpA Not tested PAGI-2 DNA 0.0 99.7
tnpA26 AFV53110.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 99.7
unnamed AEZ06025.1 TnpA26, Transposase of IS26 Not tested AbaR24 DNA 0.0 99.7
tnpA26 ACN81013.1 transposase of IS26 Not tested AbaR5 DNA 0.0 99.7
ABTW07_3877 YP_005797125.1 transposase IS26 Not tested AbaR4e DNA 0.0 99.7
ABTW07_3892 YP_005797140.1 transposase IS26 Not tested AbaR4e DNA 0.0 99.7
Pmu_03450 YP_005176243.1 IS26 transposase Not tested ICEPmu1 DNA 0.0 99.6
IS15 CAJ77077.1 Insertion sequence Not tested AbaR1 DNA 0.0 99.5
ABTW07_3872 YP_005797120.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA 0.0 99.4
unnamed - - Not tested AbaR26 DNA 0.0 99.4
ABTW07_3875 YP_005797123.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA 0.0 99.4
ABTW07_3890 YP_005797138.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA 0.0 99.4
ABTW07_3906 YP_005797154.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA 0.0 99.4
tpnIS26 ADZ05796.1 transposase Not tested AbaR17 DNA 0.0 99.3
tnpA26 ADK35781.1 transposase of IS26 Not tested AbaR8 DNA 0.0 99.3
tpnIS26 ADZ05798.1 transposase Not tested AbaR18 DNA 0.0 99.3
unnamed - - Not tested AbaR12 DNA 0.0 99.3
tpnIS26 ADZ05778.1 transposase Not tested AbaR12 DNA 0.0 99.3
tnp26 AGK36641.1 transposase of IS26 Not tested AbaR26 DNA 0.0 99.3
Pmu_03480 YP_005176246.1 IS26 transposase Not tested ICEPmu1 DNA 0.0 99.3
tpnIS26 ADZ05810.1 transposase Not tested AbaR20 DNA 0.0 99.3
IS26 CAJ77078.1 Insertion sequence Not tested AbaR1 DNA 0.0 99.3
tnpA26 AFV53109.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 99.3
tpnIS26 ADZ05794.1 transposase Not tested AbaR16 DNA 0.0 99.3
tnpA26 ACV89829.1 transposase of IS26 Not tested AbaR6 DNA 0.0 99.3
tnpA26 ACN81016.1 transposase of IS26 Not tested AbaR5 DNA 0.0 99.3
unnamed - - Not tested AbaR16 DNA 0.0 99.3
tnpA26 ACV89831.1 transposase of IS26 Not tested AbaR7 DNA 0.0 99.3
tpnIS26 ADZ05784.1 transposase Not tested AbaR14 DNA 0.0 99.1
tnp26 AGK36639.1 transposase of IS26 Not tested AbaR26 DNA 0.0 99.1