|
Name : S2011 (S2011) Accession : NP_837497.1 Strain : Shigella flexneri 2457T Genome accession: NC_004741 Putative virulence/resistance : Unknown Product : IS629 orfA Function : - COG functional category : L : Replication, recombination and repair COG ID : COG2963 EC number : - Position : 1933709 - 1934035 bp Length : 327 bp Strand : - Note : residues 1 to 108 of 108 are 80.55 pct identical to residues 1 to 108 of 108 from GenPept : >gb|AAL72409.1| (AF386526) hypothetical protein [Shigella flexneri 2a] DNA sequence : ATGACTAAAAATACTCGTTTTTCCCCCGAAGTCCGTCAACGGGCAGTCCGTATGGTTCTGGAAAGTCAGGGCGAATATGA CTCACAATGGGCGACAATTTGTTCCATTGCTCCAAAGATTGGCTGTACGCCGGAGACTCTGCGTGTCTGGGGTCGCCAGC ATGAGCGGGATACCGGGGGCGGTGATGGAGGGCTCATCACCGCTGAACGTCAGCGTCTGAAAGAGCCGGAACGTGAAAAT CGTGAACTGCGCCGCAGTAACAATATCCTTCGCCTGGCTTCCGCTTATTTTGCAAAGGCGGAGTTCGACCGCCTCTGGAA AAAATAA Protein sequence : MTKNTRFSPEVRQRAVRMVLESQGEYDSQWATICSIAPKIGCTPETLRVWGRQHERDTGGGDGGLITAERQRLKEPEREN RELRRSNNILRLASAYFAKAEFDRLWKK |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| SF3706 | NP_709445.1 | IS629 ORF1 | Not tested | SHI-2 | Protein | 2e-27 | 97 |
| unnamed | AAF09023.1 | unknown | Not tested | SHI-O | Protein | 2e-27 | 96 |
| tnpE | AAD44738.1 | TnpE | Not tested | SHI-2 | Protein | 2e-27 | 96 |
| S4062 | NP_839231.1 | IS629 orfA | Not tested | SHI-2 | Protein | 9e-27 | 95 |
| c5168 | NP_757016.1 | hypothetical protein | Not tested | PAI II CFT073 | Protein | 4e-27 | 95 |
| c5214 | NP_757062.1 | hypothetical protein | Not tested | PAI II CFT073 | Protein | 4e-27 | 95 |
| unnamed | AAL67399.1 | TnpE-like protein | Not tested | PAI II CFT073 | Protein | 3e-27 | 95 |
| S3184 | NP_838467.1 | IS629 orfA | Not tested | SHI-1 | Protein | 4e-27 | 95 |
| unnamed | ADD91740.1 | hypothetical protein | Not tested | PAI-I AL862 | Protein | 3e-27 | 95 |
| SF2979 | NP_708753.1 | IS629 ORF1 | Not tested | SHI-1 | Protein | 4e-27 | 95 |
| Z1199 | NP_286734.1 | hypothetical protein | Not tested | TAI | Protein | 8e-33 | 94 |
| Z1222 | NP_286757.1 | hypothetical protein | Not tested | TAI | Protein | 8e-33 | 94 |
| Z1639 | NP_287142.1 | hypothetical protein | Not tested | TAI | Protein | 8e-33 | 94 |
| Z1661 | NP_287163.1 | hypothetical protein | Not tested | TAI | Protein | 8e-33 | 94 |
| unnamed | CAD42084.1 | hypothetical protein | Not tested | PAI II 536 | Protein | 5e-26 | 93 |
| ECO111_3720 | YP_003236060.1 | putative IS629 transposase OrfA | Not tested | LEE | Protein | 6e-29 | 92 |
| c5177 | NP_757025.1 | hypothetical protein | Not tested | PAI II CFT073 | Protein | 1e-25 | 92 |
| IS629 | CAC37925.1 | hypothetical protein | Not tested | LEE | Protein | 2e-32 | 92 |
| ECO111_3775 | YP_003236110.1 | putative IS629 transposase OrfA | Not tested | LEE | Protein | 6e-29 | 92 |
| ECUMN_3344 | YP_002414020.1 | transposase ORF A, IS629 | Not tested | Not named | Protein | 1e-25 | 92 |
| IS629 | CAI43820.1 | hypothetical protein | Not tested | LEE | Protein | 2e-32 | 92 |
| r13 | AAC61722.1 | R13 | Not tested | PAI I CFT073 | Protein | 8e-26 | 92 |
| Z4335 | NP_289560.1 | hypothetical protein | Not tested | OI-122 | Protein | 6e-29 | 92 |
| IS629 | CAI43841.1 | hypothetical protein | Not tested | LEE | Protein | 2e-32 | 92 |
| unnamed | AAL67404.1 | R13-like protein | Not tested | PAI II CFT073 | Protein | 8e-26 | 92 |
| ECO103_3584 | YP_003223442.1 | IS629 transposase OrfA | Not tested | LEE | Protein | 2e-32 | 92 |
| IS629 | CAI43908.1 | hypothetical protein 1 | Not tested | LEE | Protein | 2e-32 | 92 |
| c3596 | NP_755471.1 | hypothetical protein | Not tested | PAI I CFT073 | Protein | 1e-25 | 92 |
| ORF_36 | AAZ04445.1 | conserved hypothetical protein | Not tested | PAI I APEC-O1 | Protein | 4e-25 | 91 |
| APECO1_3498 | YP_854313.1 | transposase; OrfA protein of insertion sequence IS629 | Not tested | PAI I APEC-O1 | Protein | 5e-25 | 91 |
| Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
| S2011 | NP_837497.1 | IS629 orfA | VFG0606 | Protein | 5e-28 | 97 |
| S2011 | NP_837497.1 | IS629 orfA | VFG0643 | Protein | 1e-27 | 95 |
| S2011 | NP_837497.1 | IS629 orfA | VFG1603 | Protein | 2e-26 | 93 |
| S2011 | NP_837497.1 | IS629 orfA | VFG1717 | Protein | 3e-26 | 92 |
