Gene Information

Name : S1912 (S1912)
Accession : NP_837422.1
Strain : Shigella flexneri 2457T
Genome accession: NC_004741
Putative virulence/resistance : Unknown
Product : IS629 orfA
Function : -
COG functional category : L : Replication, recombination and repair
COG ID : COG2963
EC number : -
Position : 1853368 - 1853694 bp
Length : 327 bp
Strand : -
Note : residues 1 to 108 of 108 are 70.37 pct identical to residues 1 to 108 of 108 from GenPept : >gb|AAL72412.1| (AF386526) hypothetical protein [Shigella flexneri 2a]

DNA sequence :
ATGACTAAAAATACTCGTTTTTCCCCCGAAGTCCGTCAACGGGCAGTCCGTATGGTTCTGGAAAGTCAGGGCGAATATGA
CTCACAATGGGCGACAATTTGTTCCATTGCTCCAAAGATTGGCTGTACGCCGGAGACTCTGCGTGTCTGGGGTCGCCAGC
ATGAGCGGGATACCGGGGGCGGTGATGGAGGGCTCACCACCGCTGAACGTCAGCGTCTGAAAGAGCCGGAACGTGAAAAT
CGTGAACTGCGCCGCAGTAACAATATCCTTCGCCTGGCTTCCGCTTATTTTGCAAAGGCGGAGTTCGACCGCCTCTGGAA
AAAATAA

Protein sequence :
MTKNTRFSPEVRQRAVRMVLESQGEYDSQWATICSIAPKIGCTPETLRVWGRQHERDTGGGDGGLTTAERQRLKEPEREN
RELRRSNNILRLASAYFAKAEFDRLWKK

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
SF3706 NP_709445.1 IS629 ORF1 Not tested SHI-2 Protein 8e-27 98
unnamed AAF09023.1 unknown Not tested SHI-O Protein 6e-27 97
tnpE AAD44738.1 TnpE Not tested SHI-2 Protein 6e-27 97
S4062 NP_839231.1 IS629 orfA Not tested SHI-2 Protein 3e-26 96
c5168 NP_757016.1 hypothetical protein Not tested PAI II CFT073 Protein 2e-26 96
unnamed AAL67399.1 TnpE-like protein Not tested PAI II CFT073 Protein 1e-26 96
c5214 NP_757062.1 hypothetical protein Not tested PAI II CFT073 Protein 2e-26 96
unnamed ADD91740.1 hypothetical protein Not tested PAI-I AL862 Protein 1e-26 96
S3184 NP_838467.1 IS629 orfA Not tested SHI-1 Protein 2e-26 96
SF2979 NP_708753.1 IS629 ORF1 Not tested SHI-1 Protein 2e-26 96
Z1199 NP_286734.1 hypothetical protein Not tested TAI Protein 2e-27 95
Z1222 NP_286757.1 hypothetical protein Not tested TAI Protein 2e-27 95
Z1639 NP_287142.1 hypothetical protein Not tested TAI Protein 2e-27 95
Z1661 NP_287163.1 hypothetical protein Not tested TAI Protein 2e-27 95
unnamed CAD42084.1 hypothetical protein Not tested PAI II 536 Protein 2e-25 94
IS629 CAI43841.1 hypothetical protein Not tested LEE Protein 4e-27 93
unnamed AAL67404.1 R13-like protein Not tested PAI II CFT073 Protein 3e-25 93
IS629 CAI43908.1 hypothetical protein 1 Not tested LEE Protein 4e-27 93
ECO103_3584 YP_003223442.1 IS629 transposase OrfA Not tested LEE Protein 6e-27 93
ECO111_3720 YP_003236060.1 putative IS629 transposase OrfA Not tested LEE Protein 1e-26 93
c3596 NP_755471.1 hypothetical protein Not tested PAI I CFT073 Protein 4e-25 93
IS629 CAC37925.1 hypothetical protein Not tested LEE Protein 4e-27 93
ECO111_3775 YP_003236110.1 putative IS629 transposase OrfA Not tested LEE Protein 1e-26 93
c5177 NP_757025.1 hypothetical protein Not tested PAI II CFT073 Protein 4e-25 93
IS629 CAI43820.1 hypothetical protein Not tested LEE Protein 4e-27 93
r13 AAC61722.1 R13 Not tested PAI I CFT073 Protein 3e-25 93
Z4335 NP_289560.1 hypothetical protein Not tested OI-122 Protein 1e-26 93
ECUMN_3344 YP_002414020.1 transposase ORF A, IS629 Not tested Not named Protein 4e-25 93
APECO1_3498 YP_854313.1 transposase; OrfA protein of insertion sequence IS629 Not tested PAI I APEC-O1 Protein 2e-24 92
ORF_36 AAZ04445.1 conserved hypothetical protein Not tested PAI I APEC-O1 Protein 2e-24 92

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
S1912 NP_837422.1 IS629 orfA VFG0606 Protein 2e-27 98
S1912 NP_837422.1 IS629 orfA VFG0643 Protein 5e-27 96
S1912 NP_837422.1 IS629 orfA VFG1603 Protein 1e-25 94
S1912 NP_837422.1 IS629 orfA VFG1717 Protein 1e-25 93