
|
Name : PF0731 (PF0731) Accession : NP_578460.1 Strain : Pyrococcus furiosus DSM 3638 Genome accession: NC_003413 Putative virulence/resistance : Unknown Product : copper-transporting atpase, p-type Function : - COG functional category : P : Inorganic ion transport and metabolism COG ID : COG2217 EC number : - Position : 726955 - 727122 bp Length : 168 bp Strand : + Note : Function Code: 14.5 Transport and Binding Proteins: Cations DNA sequence : ATGGTGCAGAATTTAGCGTGGGCAACGGGCTACAACTCCTTCGCAATTCCCCTTGCCGCTGGAGCCCTCTACTCCTACGG GATACTGCTCAGTCCGGCCCTTGGAGCCCTGCTGATGAGCATGAGCACGGTGATAGTGGCTATCAACGCGAAGTTCCTGA AGGTTTGA Protein sequence : MVQNLAWATGYNSFAIPLAAGALYSYGILLSPALGALLMSMSTVIVAINAKFLKV |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| SAPIG0065 | YP_005732875.1 | copper P-type ATPase AtkB | Not tested | Type-V SCCmec | Protein | 5e-08 | 70 |
| unnamed | BAB83474.1 | - | Not tested | SCC 12263 | Protein | 3e-08 | 70 |