Gene Information

Name : -
Accession : -
Strain :
Genome accession: NC_003384
Putative virulence/resistance : Unknown
Product : -
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 163306 - 164125 bp
Length : 820 bp
Strand : +
Note : -

DNA sequence :
GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGG
CCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGG
AGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAA
AAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGG
CCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCA
AAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAA
GCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAA
GTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGA
AGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGT
GATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATC
GCTAACTTTGCAACAGTGCC

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
tnpA26 AGK07092.1 IS26 transposase Not tested SGI1 DNA 0.0 100
unnamed - - Not tested AbaR19 DNA 0.0 100
IS26 CAJ77074.1 Insertion sequence Not tested AbaR1 DNA 0.0 100
tnpA26 AGK07095.1 IS26 transposase Not tested SGI1 DNA 0.0 100
tpnIS26 ADZ05788.1 transposase Not tested AbaR15 DNA 0.0 100
tnpA26 AGK07097.1 IS26 transposase Not tested SGI1 DNA 0.0 100
tnpA AET25383.1 TnpA Not tested PAGI-2(C) DNA 0.0 100
unnamed - - Not tested AbaR15 DNA 0.0 100
IS26 CAJ77080.1 Insertion sequence Not tested AbaR1 DNA 0.0 100
tnpA26 ACN81018.1 transposase of IS26 Not tested AbaR5 DNA 0.0 100
tnpA AFG30106.1 TnpA Not tested PAGI-2 DNA 0.0 100
tnpA26 AFV53110.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 100
unnamed AEZ06025.1 TnpA26, Transposase of IS26 Not tested AbaR24 DNA 0.0 100
tnpA26 ACN81013.1 transposase of IS26 Not tested AbaR5 DNA 0.0 100
tnpA26 AFV53107.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 100
tnpA26 AGK07034.1 IS26 transposase Not tested SGI1 DNA 0.0 100
tnp7109-28 YP_001800928.1 transposase for insertion sequence Not tested Not named DNA 0.0 100
tnpA26 AFV53122.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 100
tnpA26 AGK07037.1 IS26 transposase Not tested SGI1 DNA 0.0 100
tnpA26 ACK44541.1 TnpA Not tested SGI1 DNA 0.0 100
tnp7109-29 YP_001800930.1 transposase for insertion sequence Not tested Not named DNA 0.0 100
tnpA26 AFV53108.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 100
tnpA26 AGK07039.1 IS26 transposase Not tested SGI1 DNA 0.0 100
tpnIS26 ADZ05800.1 transposase Not tested AbaR19 DNA 0.0 100
tnpA26 ACK44543.1 TnpA Not tested SGI1 DNA 0.0 100
ABTW07_3877 YP_005797125.1 transposase IS26 Not tested AbaR4e DNA 0.0 100
ABTW07_3892 YP_005797140.1 transposase IS26 Not tested AbaR4e DNA 0.0 100
Pmu_03450 YP_005176243.1 IS26 transposase Not tested ICEPmu1 DNA 0.0 99.9
IS15 CAJ77077.1 Insertion sequence Not tested AbaR1 DNA 0.0 99.8
ABTW07_3872 YP_005797120.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA 0.0 99.7
ABTW07_3875 YP_005797123.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA 0.0 99.7
ABTW07_3890 YP_005797138.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA 0.0 99.7
ABTW07_3906 YP_005797154.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA 0.0 99.7
tnp26 AGK36641.1 transposase of IS26 Not tested AbaR26 DNA 0.0 99.6
Pmu_03480 YP_005176246.1 IS26 transposase Not tested ICEPmu1 DNA 0.0 99.6
tpnIS26 ADZ05810.1 transposase Not tested AbaR20 DNA 0.0 99.6
IS26 CAJ77078.1 Insertion sequence Not tested AbaR1 DNA 0.0 99.6
unnamed - - Not tested AbaR26 DNA 0.0 99.6
tnpA26 AFV53109.1 transposase of IS26 Not tested AbGRI2-1 DNA 0.0 99.6
tpnIS26 ADZ05794.1 transposase Not tested AbaR16 DNA 0.0 99.6
tnpA26 ACV89829.1 transposase of IS26 Not tested AbaR6 DNA 0.0 99.6
tnpA26 ACN81016.1 transposase of IS26 Not tested AbaR5 DNA 0.0 99.6
unnamed - - Not tested AbaR16 DNA 0.0 99.6
tnpA26 ACV89831.1 transposase of IS26 Not tested AbaR7 DNA 0.0 99.6
tpnIS26 ADZ05796.1 transposase Not tested AbaR17 DNA 0.0 99.6
tnpA26 ADK35781.1 transposase of IS26 Not tested AbaR8 DNA 0.0 99.6
tpnIS26 ADZ05798.1 transposase Not tested AbaR18 DNA 0.0 99.6
unnamed - - Not tested AbaR12 DNA 0.0 99.6
tpnIS26 ADZ05778.1 transposase Not tested AbaR12 DNA 0.0 99.6
tpnIS26 ADZ05784.1 transposase Not tested AbaR14 DNA 0.0 99.4
tnp26 AGK36639.1 transposase of IS26 Not tested AbaR26 DNA 0.0 99.4