Gene Information

Name : SERP2503 (SERP2503)
Accession : YP_190045.1
Strain : Staphylococcus epidermidis RP62A
Genome accession: NC_002976
Putative virulence/resistance : Unknown
Product : hypothetical protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2561251 - 2561562 bp
Length : 312 bp
Strand : +
Note : identified by similarity to OMNI:NTL01SA0059

DNA sequence :
ATGAAAATCAATCGATACATCACAAGAGGTATTAGTGAATACCTATCTCTAGACCTTCAAATCTTACTTTGGAATATGGT
AAAAGAAAGAGATAATCAACCTCATACAGATTACCTACACATTTTTAAACTGCAAGAAGATGAGAATATACTCTCAATCA
CACATGAACAAGAACAACCTGCATACAAATTGGAATATCACTATACAAACTATGTAAAAAATCAAAATGCATTACCTAAG
AAAGTCTACGTCATTCGTGAAGATGGCGTAGACGCTTTTTATTATGTGATGCTTTTACCAGAAGAATACTAA

Protein sequence :
MKINRYITRGISEYLSLDLQILLWNMVKERDNQPHTDYLHIFKLQEDENILSITHEQEQPAYKLEYHYTNYVKNQNALPK
KVYVIREDGVDAFYYVMLLPEEY

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
SAR0057 YP_039528.1 hypothetical protein Not tested Type-II SCCmec Protein 3e-43 100
SAV0059 NP_370583.1 hypothetical protein Not tested Type-II SCCmec Protein 3e-43 100
SA0055 NP_373295.1 hypothetical protein Not tested Type-II SCCmec Protein 3e-43 100
SERP2503 YP_190045.1 hypothetical protein Not tested Type-II SCCmec Protein 3e-43 100
unnamed BAA94662.1 - Not tested Type-II SCCmec Protein 2e-43 100
SE0053 NP_763608.1 hypothetical protein Not tested SCCpbp4 Protein 3e-42 99
unnamed BAB83490.1 - Not tested SCC 12263 Protein 9e-42 98
SH0058 YP_251973.1 hypothetical protein Not tested SCCmec Protein 5e-41 95
unnamed BAG06214.1 hypothetical protein Not tested Type-VII SCCmec Protein 3e-41 95
unnamed BAB46980.2 hypothetical protein Not tested Type-IIIinv SCCmec Protein 8e-39 93
SAS0030 YP_042163.1 hypothetical protein Not tested SCC476 Protein 3e-39 92
SE0031 NP_763586.1 hypothetical protein Not tested SCCpbp4 Protein 1e-39 91
SACOL0038 YP_184949.1 hypothetical protein Not tested Type-I SCCmec Protein 8e-40 91
unnamed BAA94330.1 hypothetical protein Not tested Type-I SCCmec Protein 3e-40 91
unnamed BAC67563.1 hypothetical protein Not tested Type-IVc SCCmec Protein 2e-39 90
SAMSHR1132_00370 YP_005324561.1 hypothetical protein Not tested Type-IIIinv SCCmec Protein 3e-39 90
MW0036 NP_644851.1 hypothetical protein Not tested Type-IV SCCmec Protein 3e-39 90
unnamed BAB72111.1 hypothetical protein Not tested Type-IVa SCCmec Protein 2e-39 90
unnamed BAB72130.1 hypothetical protein Not tested Type-IVb SCCmec Protein 2e-39 90
SAPIG0052 YP_005732862.1 hypothetical protein Not tested Type-V SCCmec Protein 5e-40 90
unnamed BAD24837.1 hypothetical protein Not tested Type-V SCCmec Protein 1e-39 90
unnamed ACL99846.1 hypothetical protein Not tested Type-V SCCmec Protein 3e-39 90
SAPIG0036 YP_005732846.1 hypothetical protein Not tested Type-V SCCmec Protein 2e-15 50
unnamed ACL99834.1 hypothetical protein Not tested Type-V SCCmec Protein 1e-15 50
SSP0048 YP_300138.1 hypothetical protein Not tested SCC15305cap Protein 4e-17 50
unnamed BAG06193.1 hypothetical protein Not tested Type-VII SCCmec Protein 1e-15 50
unnamed BAC53832.1 hypothetical protein Not tested SRImec-III and SCCmec-III region Protein 2e-15 49
unnamed BAB47670.1 hypothetical protein Not tested Type-III SCCmec Protein 2e-15 49
unnamed BAB47601.1 hypothetical protein Not tested Type-III SCCmec Protein 8e-17 49
SSP0032 YP_300122.1 hypothetical protein Not tested SCC15305RM Protein 1e-13 48
SARLGA251_00340 YP_005754049.1 hypothetical protein Not tested Type-XI SCCmec Protein 7e-15 48
unnamed AAL26664.1 unknown Not tested SCCcap1 Protein 4e-10 43