Gene Information

Name : SERP2219 (SERP2219)
Accession : -
Strain : Staphylococcus epidermidis RP62A
Genome accession: NC_002976
Putative virulence/resistance : Unknown
Product : -
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2256196 - 2256869 bp
Length : 674 bp
Strand : +
Note : IS431mec, transposase, authentic frameshift; this gene contains a frame shift which is not the result of sequencing error; identified by similarity to OMNI:SA0028

DNA sequence :
ATGAACTATTTCAGATATAAACAATTTAACAAAGATGTTATCACTGTAGCCGTTGGCTACTATCTAAGATATGCATTGAG
TTATCGTGATATATCTGAAATATTAAGGGAACGTGGTGTAAACGTTCATCATTCAACGGTCTACCGTTGGGTTCAAGAAT
ATGTCTCAATTTTATATCAAATTTGGAAGAAAAGCATCAAAAAGCTTATTACAAATGGCGTATTGATGAGACGTACATCA
AAATAAAAGGAAAATGGAGCTATTTATATCGTGCCATTGATGCAGAGGGACATACATTAGATATTTGGTTGCGTAAGCAA
CGAGATAATCATTCAGCATATGCGTTTATCAAACGTCTCATTAAACAATTTGGTAAACCTCAAAAGGTAATTACAGATCA
GGCACCTTCAACGAAGGTAGCAATGGCTAAAGTAATTAAAGCTTTTAAACTTAAACCTGACTGTCATTGTACATCGAAAT
ATCTGAATAACCTCATTGAGCAAGATCACCGTCATATTAAAGTAAGAAAGACAAGGTATCAAAGTATCAATACAGCAAAG
AATACTTTAAAAGGTATTGAATGTATTTACGCTCTATATAAAAAGAACCGCAGGTCTCTTCAGATCTACGGATTTTCGCC
ATGCCACGAAATTAGCATCATGCTAGCGAGTTAA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
SERP2219 - - Not tested vSe1 DNA 0.0 100
SE0090 NP_763645.1 transposase for IS-like element Not tested SCCpbp4 DNA 0.0 99.1
SAPIG0054 YP_005732864.1 transposase Not tested Type-V SCCmec DNA 0.0 99.1
unnamed BAB47648.1 putative transposase of IS431 Not tested Type-III SCCmec DNA 0.0 99
SAUSA300_0028 YP_492748.1 putative transposase Not tested Type-IV SCCmec DNA 0.0 99
SE0071 NP_763626.1 transposase for IS-like element Not tested SCCpbp4 DNA 0.0 99
tnp NP_370551.1 transposase for IS-like element Not tested Type-II SCCmec DNA 0.0 99
unnamed BAA82228.1 transposase for insertion sequence-like element IS431mec Not tested Type-II SCCmec DNA 0.0 99
tnp BAB72117.1 transposase of IS431mec Not tested Type-IVa SCCmec DNA 0.0 99
SAMSHR1132_00280 YP_005324552.1 putative transposase Not tested Type-IIIinv SCCmec DNA 0.0 99
SACOL0028 YP_184939.1 IS431mec, transposase Not tested Type-I SCCmec DNA 0.0 99
unnamed BAA82238.1 transposase for insertion sequence-like element IS431mec Not tested Type-II SCCmec DNA 0.0 99
tnp BAB72136.1 transposase of IS431mec Not tested Type-IVb SCCmec DNA 0.0 99
SAR0034 YP_039511.1 transposase Not tested Type-II SCCmec DNA 0.0 99
tnp BAC67570.1 transposase of IS431mec Not tested Type-IVc SCCmec DNA 0.0 99
SAR0027 YP_039504.1 transposase Not tested Type-II SCCmec DNA 0.0 99
tnp - - Not tested Type-IVc SCCmec DNA 0.0 99
tnp BAA86652.1 transposase Not tested Type-I SCCmec DNA 0.0 99
tnp YP_252002.1 transposase for IS431mec Not tested SCCmec DNA 0.0 99
unnamed BAB47631.1 putative transposase of IS431 Not tested Type-III SCCmec DNA 0.0 99
SA0034 NP_373274.1 transposase for IS-like element Not tested Type-II SCCmec DNA 0.0 99
SERP2526 YP_190067.1 IS431mec-like transposase Not tested Type-II SCCmec DNA 0.0 99
SA0026 NP_373265.1 transposase for IS-like element Not tested Type-II SCCmec DNA 0.0 99
unnamed BAB47638.1 putative transposase of IS431 Not tested Type-III SCCmec DNA 0.0 99
tnp NP_370560.2 transposase for IS-like element Not tested Type-II SCCmec DNA 0.0 99
SE0079 NP_763634.1 transposase for IS-like element Not tested SCCpbp4 DNA 0.0 98.8
unnamed BAB47635.1 putative transposase of IS431 Not tested Type-III SCCmec DNA 0.0 98.8
MW0027 NP_644842.1 transposase for IS-like element Not tested Type-IV SCCmec DNA 0.0 98.8
SAPIG0038 YP_005732848.1 transposase Not tested Type-V SCCmec DNA 0.0 98.7
unnamed ACL99852.1 transposase Not tested Type-V SCCmec DNA 0.0 98.7
SERP1579 YP_189144.1 IS431mec-like transposase Not tested ¥ÕSP¥â DNA 0.0 98.7
tnp BAD24823.1 transposase for IS431 Not tested Type-V SCCmec DNA 0.0 98.7
tnp YP_252034.1 transposase for IS431mec Not tested SCCmec DNA 0.0 98.7
tnp BAG06195.1 transposase for IS431 Not tested Type-VII SCCmec DNA 0.0 98.7
tnp YP_251940.1 transposase for IS431mec Not tested SCCmec DNA 0.0 98.5
tnp YP_252008.1 transposase for IS431mec Not tested SCCmec DNA 0.0 98.1
unnamed BAD24828.1 transposase for IS431 Not tested Type-V SCCmec DNA 0.0 97.8
unnamed AAP55235.1 transposase Not tested SaPIbov2 DNA 0.0 97.6
tnp YP_254240.1 transposase for IS431mec Not tested ¥ðSh1 DNA 0.0 96.8