Gene Information

Name : PP_4419 (PP_4419)
Accession : NP_746532.1
Strain : Pseudomonas putida KT2440
Genome accession: NC_002947
Putative virulence/resistance : Unknown
Product : transposase, OrfA
Function : -
COG functional category : L : Replication, recombination and repair
COG ID : COG2963
EC number : -
Position : 5014188 - 5014496 bp
Length : 309 bp
Strand : +
Note : identified by match to PFAM protein family HMM PF04218

DNA sequence :
ATGACCAAGCAACGCCGTACCTTTACCCCTGAGTTCAAGCGCGAAGCAGCCTGTCTGGTGCTCGACCAAGGCTACAGTCA
TGCCGAAGCAGCCCGCTCGTTCGGCTTGGTCGAGTCGGCCCTGCGCCGCTGGGTTAATCAGCTTCAGCAGGAGCGTGGCG
GCATCACGCCGGCCAGCAAAGCGTTGACGCCAGAGCAGCAAAAGATCCAAGAGCTTGAAGCTCGGATAACGCGCCTTGAA
CGCGAGAAATCAATACTAAAAAAGGCTACCGCGCTCTTGATGTCGGAAGATCTCGAGCGTATTCGCTGA

Protein sequence :
MTKQRRTFTPEFKREAACLVLDQGYSHAEAARSFGLVESALRRWVNQLQQERGGITPASKALTPEQQKIQELEARITRLE
REKSILKKATALLMSEDLERIR

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
RS05 AAP82950.1 putative transposase Not tested PAPI-2 Protein 3e-35 79
unnamed CAD42034.1 hypothetical protein Not tested PAI II 536 Protein 1e-20 56
VPI2_0009c ACA01826.1 transposase OrfAB subunit A Not tested VPI-2 Protein 6e-20 54
orfA AGK06911.1 IS1359 transposase; OrfA Not tested SGI1 Protein 6e-20 54
unnamed AGK06948.1 IS1359 transposase; OrfA Not tested SGI1 Protein 6e-20 54
orfA AGK06994.1 IS1359 transposase; OrfA Not tested SGI1 Protein 6e-20 54
orfA AGK07052.1 IS1359 transposase; OrfA Not tested SGI1 Protein 6e-20 54
VC1790 NP_231425.1 transposase OrfAB subunit A Not tested VPI-2 Protein 8e-20 54
orfA YP_001217330.1 transposase OrfAB subunit A Not tested VPI-2 Protein 8e-20 54
orfA ACX47959.1 IS1359 transposase; OrfA Not tested SGI1 Protein 6e-20 54
aec66 AAW51749.1 Aec66 Not tested AGI-3 Protein 7e-21 52
ECO111_3778 YP_003236113.1 putative IS602 transposase OrfA Not tested LEE Protein 1e-20 52
l7045 CAD33744.1 - Not tested PAI I 536 Protein 2e-20 51
orfA CAE85179.1 OrfA protein, IS911 Not tested PAI V 536 Protein 2e-20 51
insN YP_002152325.1 transposase for insertion sequence element IS911 Not tested Not named Protein 6e-20 50
api80 CAF28554.1 putative transposase Not tested YAPI Protein 3e-16 50
unnamed ACU09431.1 IS911 transposase orfA Not tested LEE Protein 3e-19 50
Z5088 NP_290240.1 hypothetical protein Not tested LEE Protein 3e-19 50
ECs4535 NP_312562.1 hypothetical protein Not tested LEE Protein 3e-19 50
unnamed AAC31483.1 L0004 Not tested LEE Protein 2e-19 50
unnamed CAD42047.1 hypothetical protein Not tested PAI II 536 Protein 8e-12 46
unnamed CAD33780.1 putative transposase Not tested PAI I 536 Protein 1e-10 44
trp1329A CAB46577.1 IS1329 transposase A Not tested HPI Protein 6e-14 42
tnpA CAB61575.1 transposase A Not tested HPI Protein 2e-13 41

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
PP_4419 NP_746532.1 transposase, OrfA VFG1553 Protein 4e-21 56
PP_4419 NP_746532.1 transposase, OrfA VFG1123 Protein 2e-20 54
PP_4419 NP_746532.1 transposase, OrfA VFG1485 Protein 8e-21 51
PP_4419 NP_746532.1 transposase, OrfA VFG0784 Protein 8e-20 50
PP_4419 NP_746532.1 transposase, OrfA VFG1566 Protein 3e-12 46
PP_4419 NP_746532.1 transposase, OrfA VFG1521 Protein 5e-11 44