Name : ECs2637 (ECs2637) Accession : NP_310664.1 Strain : Escherichia coli Sakai Genome accession: NC_002695 Putative virulence/resistance : Unknown Product : transposase Function : - COG functional category : L : Replication, recombination and repair COG ID : COG2963 EC number : - Position : 2604288 - 2604614 bp Length : 327 bp Strand : - Note : OrfA protein of insertion sequence IS629; similar to hypothetical proteins in insertion sequences e.g. [Escherichia coli plasmid pO157 insertion sequence IS629] gi|7444868|pir||T00241 DNA sequence : ATGACTAAAAATACACGTTTTTCCCCCGAGGTCCGTCAACGGGCAGTCCGTATGGTTCTGGAAAGTCAGGGCGAATATGA CTCACAATGGGCGGCAATTTGTTCCATTGCCCCAAAGATTGGCTGTACACCAGAGACTCTGCGTGTGTGGGTTCGTCAGC ATGAGCGGGATACCGGGGGCGGTGATGGTGGACTCACCACCGCTGAACGTCAGCGTCTGAAAGAGCTGGAACGTGAAAAT CGTGAACTGCCCCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTTGCGAAGGCGGAGTTCGACCGCCTCTGGAA AAAATAA Protein sequence : MTKNTRFSPEVRQRAVRMVLESQGEYDSQWAAICSIAPKIGCTPETLRVWVRQHERDTGGGDGGLTTAERQRLKELEREN RELPRSNDILRQASAYFAKAEFDRLWKK |
Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
Z1199 | NP_286734.1 | hypothetical protein | Not tested | TAI | Protein | 3e-30 | 99 |
Z1222 | NP_286757.1 | hypothetical protein | Not tested | TAI | Protein | 3e-30 | 99 |
unnamed | AAF09023.1 | unknown | Not tested | SHI-O | Protein | 2e-29 | 99 |
Z1639 | NP_287142.1 | hypothetical protein | Not tested | TAI | Protein | 3e-30 | 99 |
tnpE | AAD44738.1 | TnpE | Not tested | SHI-2 | Protein | 2e-29 | 99 |
Z1661 | NP_287163.1 | hypothetical protein | Not tested | TAI | Protein | 3e-30 | 99 |
unnamed | AAL67399.1 | TnpE-like protein | Not tested | PAI II CFT073 | Protein | 6e-29 | 98 |
c5214 | NP_757062.1 | hypothetical protein | Not tested | PAI II CFT073 | Protein | 8e-29 | 98 |
unnamed | ADD91740.1 | hypothetical protein | Not tested | PAI-I AL862 | Protein | 6e-29 | 98 |
S3184 | NP_838467.1 | IS629 orfA | Not tested | SHI-1 | Protein | 8e-29 | 98 |
SF2979 | NP_708753.1 | IS629 ORF1 | Not tested | SHI-1 | Protein | 8e-29 | 98 |
SF3706 | NP_709445.1 | IS629 ORF1 | Not tested | SHI-2 | Protein | 3e-29 | 98 |
S4062 | NP_839231.1 | IS629 orfA | Not tested | SHI-2 | Protein | 1e-28 | 98 |
c5168 | NP_757016.1 | hypothetical protein | Not tested | PAI II CFT073 | Protein | 8e-29 | 98 |
ECO111_3720 | YP_003236060.1 | putative IS629 transposase OrfA | Not tested | LEE | Protein | 3e-29 | 97 |
IS629 | CAC37925.1 | hypothetical protein | Not tested | LEE | Protein | 9e-30 | 97 |
ECO111_3775 | YP_003236110.1 | putative IS629 transposase OrfA | Not tested | LEE | Protein | 3e-29 | 97 |
IS629 | CAI43820.1 | hypothetical protein | Not tested | LEE | Protein | 9e-30 | 97 |
Z4335 | NP_289560.1 | hypothetical protein | Not tested | OI-122 | Protein | 3e-29 | 97 |
IS629 | CAI43841.1 | hypothetical protein | Not tested | LEE | Protein | 9e-30 | 97 |
IS629 | CAI43908.1 | hypothetical protein 1 | Not tested | LEE | Protein | 9e-30 | 97 |
ECO103_3584 | YP_003223442.1 | IS629 transposase OrfA | Not tested | LEE | Protein | 1e-29 | 97 |
c3596 | NP_755471.1 | hypothetical protein | Not tested | PAI I CFT073 | Protein | 8e-28 | 96 |
c5177 | NP_757025.1 | hypothetical protein | Not tested | PAI II CFT073 | Protein | 8e-28 | 96 |
unnamed | CAD42084.1 | hypothetical protein | Not tested | PAI II 536 | Protein | 1e-27 | 96 |
ECUMN_3344 | YP_002414020.1 | transposase ORF A, IS629 | Not tested | Not named | Protein | 8e-28 | 96 |
r13 | AAC61722.1 | R13 | Not tested | PAI I CFT073 | Protein | 5e-28 | 96 |
unnamed | AAL67404.1 | R13-like protein | Not tested | PAI II CFT073 | Protein | 5e-28 | 96 |
APECO1_3498 | YP_854313.1 | transposase; OrfA protein of insertion sequence IS629 | Not tested | PAI I APEC-O1 | Protein | 1e-26 | 95 |
ORF_36 | AAZ04445.1 | conserved hypothetical protein | Not tested | PAI I APEC-O1 | Protein | 7e-27 | 95 |
Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
ECs2637 | NP_310664.1 | transposase | VFG0643 | Protein | 2e-29 | 98 |
ECs2637 | NP_310664.1 | transposase | VFG0606 | Protein | 7e-30 | 98 |
ECs2637 | NP_310664.1 | transposase | VFG1603 | Protein | 4e-28 | 96 |
ECs2637 | NP_310664.1 | transposase | VFG1717 | Protein | 2e-28 | 96 |